Entry information : AdurRboh06(aradu.Aradu.JTK38.1)
Entry ID 16306
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-23 (Christophe Dunand)
Peroxidase information: AdurRboh06(aradu.Aradu.JTK38.1)
Name AdurRboh06(aradu.Aradu.JTK38.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis duranensis    [TaxId: 130453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdurRboh06
start..stop
S start..stop
AipaRboh09 1871 0 1..973 1..971
CausRboh02 1534 0 13..973 14..937
NschRboh02 1526 0 1..973 1..930
MtRboh04 1501 0 12..973 11..923
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 205..940 736 N° 2 1118..1280 163 N° 3 1393..1441 49 N° 4 1600..1713 114
N° 5 2052..2477 426 N° 6 2710..3093 384 N° 7 3622..3717 96 N° 8 3838..3953 116
N° 9 4090..4192 103 N° 10 4524..4597 74 N° 11 6168..6718 551 N° 12 7477..7586 110
join(205..940,1118..1280,1393..1441,1600..1713,2052..2477,2710..3093,3622..3717, 3838..3953,4090..4192,4524..4597,6168..6718,7477..7586)


exon

Literature and cross-references AdurRboh06(aradu.Aradu.JTK38.1)
Cluster/Prediction ref. Genebank:   107463420
Protein sequence: AdurRboh06(aradu.Aradu.JTK38.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   973
PWM (Da):   %s   108780.01  
PI (pH):   %s   9.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKSDEDFYNRHHHRRDNSDIELVAGDRVPHSGPLSKRLARRSSKLNNNNNNEALVVHGNDDVITSTSSSCKQQVDHDDGGGQDYVEVTMDIHGGSVALHSVKDVSGNDLNEDDKLVLLGKGMEKKRSFGATVVRTASIKMKQVSQELKRLASISSKQTAPSSSSDAAAAARRGHYDRTKSAASSALKGLKFIAKGGGGGGGGGGGGGGGGGGGGAGWHEVEKQFDVLTASTDGWLHRSLFGKCIGMSKESEAFAGVLFDSLARRRDIHGDSINKAQLKDFWDQISDQSFDSRLRTFFDMVDKDADGRITEEEIKIICLSATTNKLSNIQLQAEEYAALIMEELDPEETGFIMLDSLEMLLLHGPSHSTRGDSKYLSQMLSLKLKPTYEDSAVRRCYTNTKYFIQDNWQRTWVMALWICVMLGLFAYKFIHYRRRKDVYHVMGYCVCMAKGAAETLKLNMAIILLPVCRNTITWLRNKSKLGIMVPFDDNLNFHKVIAVAVAIGVGIHAIFHLSCDFPRLLRASPQKYKPMVQYFGPQPKSYWHFVKTWEGVTGIIMVVLMAIAFTLASPWFRRGRVKLPKPLNSLTGFNAFWYSHHLFVIVYASLIVHGIKLFMTKEWYEKTTWMYLAIPMTIYSLERLTRALRSSIKPVKILKVAVYPGNVLALHMSKPQGFRYKSGQYMFVNCAAVSPFEWHPFSITSAPEDNYLSVHIRTLGDWTRSLRTKFSVCQPPNNGKSGLLRAECMTGDCCPSTFPKVLIDGPYGAPAQDYKQYEVVLLVGLGIGATPMISILKDIVNNYKAMEEDELGSTMEEGGVTSSDNKSPKRRGNLVNFKTRRAYFYWVTREQGSFDWFKGVMNEVADADRRGVIELHNYCTSVYEEGDARSALIEMLQSLNHAKNGVDIVSGTRIKSHFAKPNWRSVYKRIALNHPHARGVFYCGPPALTKELRQLASDFSHNTTTKYDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAAAATCTGATGAAGATTTTTATAACCGTCACCACCACCGTCGTGATAATTCCGACATAGAACTCGTCGCCGGTGATAGAGTTCCTCATTCTGGCCCTCTAAGCAAAAGACTGGCA
AGAAGAAGTTCCAAGTTGAATAATAATAATAATAATGAAGCTCTTGTTGTTCATGGAAATGATGACGTCATCACTTCAACTTCTTCTTCTTGTAAGCAACAAGTGGATCATGATGATGGA
GGAGGACAAGACTACGTTGAAGTCACAATGGACATTCATGGCGGTTCCGTTGCGCTTCACAGCGTCAAAGACGTTTCAGGTAACGACCTTAACGAAGACGACAAGCTTGTTCTTCTCGGT
AAAGGAATGGAGAAGAAGAGATCCTTTGGTGCTACTGTCGTTAGAACCGCTTCCATTAAAATGAAGCAGGTTTCTCAAGAACTCAAACGACTCGCTTCGATTTCTTCGAAACAAACAGCA
CCTTCTTCTTCTTCTGATGCTGCTGCTGCTGCAAGAAGAGGACACTACGATAGGACTAAGTCCGCGGCTTCGAGTGCTCTCAAGGGACTTAAGTTCATCGCTAAGGGTGGCGGCGGCGGC
GGTGGTGGTGGTGGTGGTGGCGGTGGCGGTGGTGGTGGTGGTGGTGCAGGGTGGCATGAAGTGGAGAAGCAGTTTGATGTTCTTACTGCTTCAACTGATGGATGGCTTCATCGTTCTCTC
TTTGGAAAATGTATAG
GTAATAATTGAAATTGAAGAGTTCATAACAAATCTGCACTATTTTTTGTTGTTGCTTTCCAAGTGTTTGTGAAATTGTTTGTGTGTGTGAGTGAAATAAGGATT
TGTTCTGAGTAGTTTTCTTTTAGGATGTGTTTGGATAATTATGGTTTGGATTTGTTGAATTGTTTGTATGTAGGAATGAGCAAGGAATCTGAGGCATTTGCTGGTGTGCTTTTTGATTCT
TTGGCTAGGAGGAGAGATATTCATGGGGATTCAATTAACAAGGCTCAATTGAAGGACTTTTGGGACCAGATTTCTGACCAGAGTTTTGATTCCAGGCTCAGAACCTTCTTTGACAT
GTAA
CTAATTCATTACCTCTTTACTTAATTTTAGAAGTAGGAAAAGAAATTGGTTGCTATTTTCTTTAATTCCCACCATTAAGTATGTTAACCTTCATTTGGAATAATGCAGGGTTGATAAAGA
TGCCGATGGAAGAATCACCGAGGAAGAAATTAAAGAG
GTTTATATGAATTATCTTTTTAAATTCATCAACAGAAAAATTAGAATGAGGATAGTGAAGTAGTTTTATCAACAACCTTTTTT
CCTTTCCTAGCTTTGCATTTTGTTCCCATGAGAATAGGAGTTTCCTTGATCACAAATGATCAATTCTGTTTTCAGATCATCTGCCTTAGTGCCACAACAAACAAACTCTCAAACATACAG
CTGCAGGCTGAAGAATATGCAGCTTTGATCATGGAAGAACTAGACCCTGAAGAGACAGGATTTATCATG
GTATTTACATCATCCTATTTCATATCGTTTTGGTATAAAACTTATCAAAAT
TAAGTAAAATTAGTCACTATTACAGTTTCACATACAGATAAGTACTAATATTTCAAATCATAAGTAAGAAGTTGATTTATATGTAAGATGATGAGAGGGACTGATTTCACTTGTATTTAG
GAAACTAGATCAAATCCATAAGAACAATTTTACAAAGACCAAAATCATAACTAGCTAACTCTAGAAGTGACTAGAAATTTATTTGAAAAGAAAAACAAAAACTCCATATTACTCATGTTA
ATCTCATTTATTTGGCCAATTGGTGATTATTATTACTGCTTCATCAGCTGGATAGCCTAGAGATGCTCTTATTGCATGGACCAAGTCATTCTACAAGAGGTGATAGCAAGTACCTAAGCC
AAATGCTAAGCTTGAAACTGAAGCCTACATACGAAGACAGTGCTGTTAGGAGGTGCTATACAAACACCAAGTACTTCATACAGGACAACTGGCAAAGAACTTGGGTTATGGCACTGTGGA
TTTGTGTGATGTTAGGTTTATTTGCCTACAAATTCATACACTATAGAAGGAGAAAAGATGTATATCATGTTATGGGGTATTGTGTATGCATGGCCAAAGGTGCAGCTGAGACACTTAAAT
TGAACATGGCTATTATCTTGTTACCAGTTTGCCGGAACACTATTACTTGGCTGAGGAATAAGAGCAAGCTTGGCATCATGGTTCCTTTTGATGACAACCTTAACTTCCACAAG
GTACTAT
TTTTCACTTGCACCAAATCTTTGTTGGGACTTGTGTGTTTTCACAAGTCAAATTGTCAAAAGGGTATGAAGAATATTTGGAGTGTTTCATGATTTAGAAGTGGCAAATTTGCTTCTCAAG
GAACATATTGTTTCTCAAGATTCCCTTGCTGAATAAATGTGTCACCATTTAAATAAAGTTAGTAGTACAAATAAAGTGAGGGTATATATGTTGTTGTTCTTGCAGGTGATAGCTGTGGCA
GTAGCAATTGGTGTTGGAATACATGCAATTTTTCATCTTTCTTGCGACTTCCCTCGCCTCCTTCGTGCAAGCCCTCAAAAGTACAAGCCAATGGTACAGTATTTTGGACCTCAACCAAAA
AGTTATTGGCATTTTGTGAAAACATGGGAAGGAGTCACAGGGATTATAATGGTTGTTCTAATGGCAATAGCATTCACATTGGCCTCACCTTGGTTCAGGAGAGGCAGGGTTAAGCTTCCT
AAACCACTCAACAGTCTAACTGGCTTCAATGCATTTTGGTACTCACATCATCTCTTTGTCATTGTCTATGCCTCGTTGATTGTTCATGGAATCAAACTTTTCATGACCAAAGAGTGGTAC
GAGAAAACG
GTTAGTAACTTCGATCCCTTTTCCTTTGTATAAATTGCACTGACACTTTCCTGAGGTTAAAGTTAAATTATATACAACACTTTATTTTTTTAATGTTTGCATTGACTTTGT
TAGTGTTGTGTTTATAAAAGAAATTAATATCACAGGCTCACAGCTTACAATCTATAGAAATTCATTAAAAATTTAAAATATACTATTGGAAATATCAAAACAGAGAAGTATTGTGTGTAT
TATTGTCTAATGTCAAGACTAGAGAAAAGCCATCGGAATTTACCCTTTTTCTTTTTAGAATAAATTATCATTTTTAATCATAAAGGATTCAAATGCCAACAATTTTAACTATAACAAGCT
AAACTAATTCAATATTTAATAAAGATTGAGTTAGTTTGACAAAATTACTTAATGAATTATCCAATTTTAGTTTACATCTTTGTTGGTTATTAGAAATGATAGTTTATTTTTATTTGTTAT
CTTTTATTTATCTTTTTTACCCTGCAAAATTTGATGTTGTATGAATATGTTTTGTAGACTTGGATGTACTTGGCAATTCCCATGACCATTTATTCATTGGAAAGACTAACTAGAGCACTA
AGATCTAGTATCAAACCTGTAAAAATATTAAAG
GTGAGTATCAAATCAAATAAATAGAATTCATTTACTCATTATATGAAAGAAACACGTTTGCTAATATTAGCACATAAAATAGTAATT
CTTACCACATTTTCACTGATGACTAATTTGAAGGTGGCTGTATACCCTGGGAATGTGTTGGCTCTTCATATGTCAAAGCCTCAGGGATTTAGATATAAGAGTGGACAATACATGTTTGTT
AATTGTGCTGCTGTATCACCATTTGAATG
GTATGATGAATAATTTGGAGAAACCTAAGTAACTTTTTTGTTATATAGAAATTTTGCTTCTTAGTTTCTTTCATATAACTTTTAGTAGTAT
TAATATCTAAATTCTTATTATGTTAATTTGTTTATGCTTTTACAGGCATCCATTTTCTATAACATCAGCCCCTGAAGATAACTATCTTAGTGTTCACATTAGAACATTAGGGGATTGGAC
CAGAAGTCTCAGAACAAAATTTTCAGAG
GTGAATTATCCTTCAAGTTAACTTTTGTTGGTAATACTATTTGCATAAGAGTTTCATTAAAATAGTAACAAACAAAATATCACTAGTATATA
AATTATTACATTTGCTTCTAGAATTGCAATATCACATCAATTTTATTTTAGTATTATTATTTAGTTATCATTATTATTTTCAAATCCGCGTGCTATCATTGTCTTGTGTACATATGTGGT
CTCTTTTTGTCTCCCTCATACATAATTTAATGTTAGTGTATCCTTTTTAAATAAAAAATAAATGAACTGGGTTTCTTGTAATTAAACAATGAATAGATTAATTCTTTGGGTCCTTTCAGG
TGTGCCAGCCACCCAACAATGGCAAGAGTGGACTTCTAAGGGCTGAGTGTATGACAGGAGATTGCTGTCCAAG
GTCAGCCACATTTTTAATTGGGAAAATTAGAAGAAAAAATGCCAGTT
CCATAATGGAAAAAAAAAAATTGCAGTCTCAAAAGTGGACTTTAAAACGATTTAAGGGAAAAAAGGGTTTATATAAGTTTTAAATTCTTGTAAAATTAGCAATCTAAAATTTTTAATCTT
ATATTTTCTTATTATATTTTGGTCTAAAAATTTGGAAAATAAGTAAATTTGGTTTCTACTATCATTCCATGTACAAATTATTTGGGATATATATATATATACAAAAAATCAACCACTAGA
ATAAAATACAGTTGAAATACGAAATAATATTAAAAATAAGTTAAATAATACGTATATTTATACATAAATACATAGTGACATAACATTTTTGATATACATATATATACTTGAATAACAAAT
ATATGTGAACTTTTGTGAAACACAGACAAGGACTTGTTTCATTTACTTATAAAAAAATTTGTATCGAAACCCAAAAAATATTAGAGACCAAAATCATAAATCACTAATTTCAGACAGACA
TTACCACAACATACCTAAGTATAACCAAGCCCCTATATAAAAAAAAAATAAGTATAATCAAGTATGCAGTTTATGGCGTACCAAAACTACTTGGTATGATTTATGAAATTTAAAGAAAAC
TATAGAAGTATAAATGATCTTATTAATGTTTGTTGACCAAACAACATAAATAGAACTTATTATATATTTGGCCTTTCTGGTTTGGTTGTAAATAAAAAGCACTTGTTGCGGAGATTCCCT
TAAATCTTAATAATCAAAGTGACCAAATCTAATAAATGTTAATAATGATTGTTAATGAAAACATGTGGTTAGTTGTTATTCGGATCTTGGAAGGTTGATAAGGACTCCAGTTGAAAATCC
TTGCCTGTGTGTGGTAGGTAGTCAAACCAATCAAATTTCTGTATTCATGAAATAGTTGAATCAATCAATGCGTAACTAATTATAATAGAGAAAGCTGTGTAGAAGTAGAACTGTAGCTTG
TGATGAAATAGTTGAGTAGATTGACATTTTCTTCTTGAACTACAATCAAGATTTTATAATTGTTTTTATGTGAATTTTTTTTAATTTTTGGATCATAGATTGTATAGTTAGATTTTGATA
TTTATAAAAGTGTTGTTTTTATTTAAAATGTCATTAAATAAATAATCACACTTTTAAACAAAGTATCTTCGTGAAAAGATGTTTTTGCCATCTTCATTTGAGTAGTTCTCTCTTCTTATT
ACCTATATATTTGATATCTGCCGACATATTAATACTTTTGCCAAAAAAAAAAACTACACTACTTTATAATAAAATTACAAGAATATTCAATCAATATAAATAGTTATCCATTACAATAAT
TACTCGTTATAATTTGCCATTGTAATACAATTTTATTTACTCGTAATATAAAGCTATGTAACACTTTCAACACATGAAATCAATATATGTACGTGTGGATATTTTTGTTAAGAATATATA
ATTGATACTTTGTCAAAATCAAATTCTATTGCCTAAAGACAATCAAGATTATTGATGATAAATTTGGTCACATCATGGTGCAGTACCTTCCCTAAGGTCCTAATTGATGGTCCATATGGA
GCCCCAGCACAAGACTACAAACAATATGAAGTGGTTCTATTGGTAGGGTTGGGAATTGGGGCCACCCCTATGATCAGCATACTGAAGGACATAGTGAACAATTATAAGGCCATGGAAGAG
GATGAATTAGGGTCCACCATGGAAGAAGGAGGAGTAACATCAAGTGATAACAAATCACCAAAAAGGAGGGGTAATTTGGTAAATTTCAAGACTAGGAGGGCTTACTTCTATTGGGTGACA
AGGGAACAAGGTTCATTTGATTGGTTCAAAGGTGTAATGAATGAGGTTGCTGATGCTGATCGTAGAGGAGTGATTGAGTTACATAACTATTGCACTAGTGTTTATGAAGAAGGTGATGCT
CGTTCAGCCCTAATTGAAATGCTTCAATCCTTAAACCATGCTAAGAATGGTGTTGACATTGTTTCTGGGACAAGGATTAAGTCTCACTTTGCCAAACCTAATTGGCGAAGTGTTTACAAG
CGTATTGCACTAAATCATCCACATGCTCGCATTG
GTGAGTTTTCTTTGCAAAATTTATAGAATTTTTATACCTATATTTCTTTATTCTTTGCTTTTTCCAAAATTTTAAAGGAAAAAAAA
ATTAAAGTTAAAAGAAAACTAAAATCAGAAAAATTAAACAAATCAAAATTTTTCTCCTTATTTTCTAAAGAGTAAATAACAATTTTGACACTTAAAAAAATTTTAAGACAAAATAGACTT
CGATTTTTGTTTTTGACAAAATAAATTTTTAAATATCAGTTCTGTCTGACAAAATAGACTAATTATTGATCCATCATTTTAGACATTTAGACTGTTTTATTAAACCGAACTAATATTTTA
AAGTTTATTTTATCAAAAATAAAAGTTAAAATCCATTTATCAAAACAAAATTGTGTTGAGTGCTGAAATAATTATTTACTCTTTCCTAAATAAAGTTGCATAGAAAGAAGAATATGTCTA
AAAGATTTTTGATAGATATAGAGATTATCTCTAGATGAGATAAGCATGATCATTAGATGACATTAGCAATAAACACATATTATATGATTCTAACAACTTACAACCAAACCTTTTTCCTTC
TTTCTTTTATAAACAATGCCTTTTTTCCACAGATGACCATAATTCACATAGAGGCCCATTTAATTAAAGAACATTTATGTTTATGAATCATTGTCTTCCAAAAAGTTGGAGTAATAATGC
CTAACATCTGCCTAATAATGTCTGCATCATAACAAAAAGCATAATGTTTCGTGTTTGCAATAATGTATGTAGGGGTTTTCTATTGTGGTCCACCAGCACTAACAAAGGAGCTTCGTCAGC
TAGCTTCAGATTTTTCACACAACACAACGACCAAATATGATTTCCATAAGGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAAAATCTGATGAAGATTTTTATAACCGTCACCACCACCGTCGTGATAATTCCGACATAGAACTCGTCGCCGGTGATAGAGTTCCTCATTCTGGCCCTCTAAGCAAAAGACTGGCA
AGAAGAAGTTCCAAGTTGAATAATAATAATAATAATGAAGCTCTTGTTGTTCATGGAAATGATGACGTCATCACTTCAACTTCTTCTTCTTGTAAGCAACAAGTGGATCATGATGATGGA
GGAGGACAAGACTACGTTGAAGTCACAATGGACATTCATGGCGGTTCCGTTGCGCTTCACAGCGTCAAAGACGTTTCAGGTAACGACCTTAACGAAGACGACAAGCTTGTTCTTCTCGGT
AAAGGAATGGAGAAGAAGAGATCCTTTGGTGCTACTGTCGTTAGAACCGCTTCCATTAAAATGAAGCAGGTTTCTCAAGAACTCAAACGACTCGCTTCGATTTCTTCGAAACAAACAGCA
CCTTCTTCTTCTTCTGATGCTGCTGCTGCTGCAAGAAGAGGACACTACGATAGGACTAAGTCCGCGGCTTCGAGTGCTCTCAAGGGACTTAAGTTCATCGCTAAGGGTGGCGGCGGCGGC
GGTGGTGGTGGTGGTGGTGGCGGTGGCGGTGGTGGTGGTGGTGGTGCAGGGTGGCATGAAGTGGAGAAGCAGTTTGATGTTCTTACTGCTTCAACTGATGGATGGCTTCATCGTTCTCTC
TTTGGAAAATGTATAG
GAATGAGCAAGGAATCTGAGGCATTTGCTGGTGTGCTTTTTGATTCTTTGGCTAGGAGGAGAGATATTCATGGGGATTCAATTAACAAGGCTCAATTGAAGGAC
TTTTGGGACCAGATTTCTGACCAGAGTTTTGATTCCAGGCTCAGAACCTTCTTTGACAT
GGTTGATAAAGATGCCGATGGAAGAATCACCGAGGAAGAAATTAAAGAGATCATCTGCCTT
AGTGCCACAACAAACAAACTCTCAAACATACAGCTGCAGGCTGAAGAATATGCAGCTTTGATCATGGAAGAACTAGACCCTGAAGAGACAGGATTTATCATG
CTGGATAGCCTAGAGATG
CTCTTATTGCATGGACCAAGTCATTCTACAAGAGGTGATAGCAAGTACCTAAGCCAAATGCTAAGCTTGAAACTGAAGCCTACATACGAAGACAGTGCTGTTAGGAGGTGCTATACAAAC
ACCAAGTACTTCATACAGGACAACTGGCAAAGAACTTGGGTTATGGCACTGTGGATTTGTGTGATGTTAGGTTTATTTGCCTACAAATTCATACACTATAGAAGGAGAAAAGATGTATAT
CATGTTATGGGGTATTGTGTATGCATGGCCAAAGGTGCAGCTGAGACACTTAAATTGAACATGGCTATTATCTTGTTACCAGTTTGCCGGAACACTATTACTTGGCTGAGGAATAAGAGC
AAGCTTGGCATCATGGTTCCTTTTGATGACAACCTTAACTTCCACAAG
GTGATAGCTGTGGCAGTAGCAATTGGTGTTGGAATACATGCAATTTTTCATCTTTCTTGCGACTTCCCTCGC
CTCCTTCGTGCAAGCCCTCAAAAGTACAAGCCAATGGTACAGTATTTTGGACCTCAACCAAAAAGTTATTGGCATTTTGTGAAAACATGGGAAGGAGTCACAGGGATTATAATGGTTGTT
CTAATGGCAATAGCATTCACATTGGCCTCACCTTGGTTCAGGAGAGGCAGGGTTAAGCTTCCTAAACCACTCAACAGTCTAACTGGCTTCAATGCATTTTGGTACTCACATCATCTCTTT
GTCATTGTCTATGCCTCGTTGATTGTTCATGGAATCAAACTTTTCATGACCAAAGAGTGGTACGAGAAAACG
ACTTGGATGTACTTGGCAATTCCCATGACCATTTATTCATTGGAAAGA
CTAACTAGAGCACTAAGATCTAGTATCAAACCTGTAAAAATATTAAAG
GTGGCTGTATACCCTGGGAATGTGTTGGCTCTTCATATGTCAAAGCCTCAGGGATTTAGATATAAGAGTGGA
CAATACATGTTTGTTAATTGTGCTGCTGTATCACCATTTGAATG
GCATCCATTTTCTATAACATCAGCCCCTGAAGATAACTATCTTAGTGTTCACATTAGAACATTAGGGGATTGGACC
AGAAGTCTCAGAACAAAATTTTCAGAG
GTGTGCCAGCCACCCAACAATGGCAAGAGTGGACTTCTAAGGGCTGAGTGTATGACAGGAGATTGCTGTCCAAGTACCTTCCCTAAGGTCCTA
ATTGATGGTCCATATGGAGCCCCAGCACAAGACTACAAACAATATGAAGTGGTTCTATTGGTAGGGTTGGGAATTGGGGCCACCCCTATGATCAGCATACTGAAGGACATAGTGAACAAT
TATAAGGCCATGGAAGAGGATGAATTAGGGTCCACCATGGAAGAAGGAGGAGTAACATCAAGTGATAACAAATCACCAAAAAGGAGGGGTAATTTGGTAAATTTCAAGACTAGGAGGGCT
TACTTCTATTGGGTGACAAGGGAACAAGGTTCATTTGATTGGTTCAAAGGTGTAATGAATGAGGTTGCTGATGCTGATCGTAGAGGAGTGATTGAGTTACATAACTATTGCACTAGTGTT
TATGAAGAAGGTGATGCTCGTTCAGCCCTAATTGAAATGCTTCAATCCTTAAACCATGCTAAGAATGGTGTTGACATTGTTTCTGGGACAAGGATTAAGTCTCACTTTGCCAAACCTAAT
TGGCGAAGTGTTTACAAGCGTATTGCACTAAATCATCCACATGCTCGCATTG
GGGTTTTCTATTGTGGTCCACCAGCACTAACAAAGGAGCTTCGTCAGCTAGCTTCAGATTTTTCACAC
AACACAACGACCAAATATGATTTCCATAAGGAGAATTTCTAA

Retrieve as FASTA