Entry information : AdurRboh07(aradu.Aradu.QX29C.1)
Entry ID 16307
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-17 (Christophe Dunand)
Peroxidase information: AdurRboh07(aradu.Aradu.QX29C.1)
Name AdurRboh07(aradu.Aradu.QX29C.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis duranensis    [TaxId: 130453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdurRboh07
start..stop
S start..stop
AipaRboh03 1962 0 1..946 1..946
NschRboh06 1793 0 1..946 1..951
CcaRboh05 1760 0 1..946 1..945
CcaRboh01 1760 0 1..946 1..945
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 741..1392 652 N° 2 1617..1776 160 N° 3 2127..2175 49 N° 4 2909..3022 114
N° 5 4334..4756 423 N° 6 4890..5276 387 N° 7 5369..5464 96 N° 8 5601..5716 116
N° 9 5924..6091 168 N° 10 6184..6343 160 N° 11 6501..6698 198 N° 12 6805..6933 129
N° 13 7042..7120 79 N° 14 7219..7328 110  
join(741..1392,1617..1776,2127..2175,2909..3022,4334..4756,4890..5276,5369..5464 ,5601..5716,5924..6091,6184..6343,6501..6698,6805..6933,7042..7120,7219..7328)


exon

Literature and cross-references AdurRboh07(aradu.Aradu.QX29C.1)
Cluster/Prediction ref. Genebank:   107479838
Protein sequence: AdurRboh07(aradu.Aradu.QX29C.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   946
PWM (Da):   %s   107079.5  
PI (pH):   %s   9.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNGHPKHQRRWASDTVPARATVSAGTSPGTESTSAGGEEFVEVTLDLQDDDTIVLRSVEPATVINVVVDSGTTGGSGHETPASISRSPTIRRTSSRGLRQFSQELKAEAVAKAKQFSHELKAELRRFSWSRSSSSAQNVGGSNAGGGFETALAARALRKQRAQLDRTRSGAHKALRGLRFISSKSNNGVDAWNEVQSNFNRLAKDGYLHRSDFAQCIGMRDSKEFALELFDALSRKRRLTVEKISRDELFEYWTQITDQSFDSRLQIFFDMVDKNEDGRITEEEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRARSPIRRASRRLVYYLQENWRRLWLLTLWVCIMIGLFTWKFFQYKQKDAFQIMGYCLLTAKGAAETLKFNMAIILLPVCRNTITWLRSTKLAYAVPFDDNINFHKTIAAAIVVGVILHAGDHLACDFPRLVRASEADYEKYLKGVFGDHKPSYLDIVKGIEGVTGILMVILMSIAFTLATKWFRRNLIKLPKPFSRLTGFNAFWYSHHLFVIVYVLLIIHGIKLYLVHKWYLKTTWMYLSIPVLLYAAERTIRFFRSGFYTVRLIKVAIYPGNVLTLQMSKPPQFRYKSGQYMFVQCPAVSPFEWHPFSITSSPGDDYLSVHIRQLGDWTQELKRVFAEACEPPVSGKSGLLRADETTKKSLPKLKIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIIKMEEQDSVSDISRGSDQSVGSTDSPSLNKIAPKRKKTLKTTNAYFYWVTREQGSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVFSKMCSKHYGGRIGVFYCGAPVLAKELNKLCFEFNEKGPTKFEFHKEHF

Retrieve as FASTA  
Remarks Isoform X1
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACGGTCATCCGAAGCACCAGCGCAGGTGGGCATCCGACACCGTTCCCGCCAGAGCAACCGTCAGTGCAGGAACTTCGCCGGGAACAGAGTCAACCTCCGCCGGCGGAGAAGAGTTT
GTGGAGGTCACTCTCGATCTTCAAGACGATGACACTATCGTCCTTCGGAGCGTTGAACCAGCCACTGTCATTAACGTTGTTGTTGACAGTGGTACCACTGGTGGCAGTGGACACGAAACT
CCGGCGTCTATTTCTAGGTCGCCGACGATCCGGCGGACCTCGTCGAGAGGCTTGCGGCAGTTCTCGCAGGAGCTGAAGGCGGAGGCGGTTGCAAAGGCAAAGCAGTTCTCGCATGAGCTT
AAGGCAGAGCTGCGACGGTTCTCGTGGAGCCGTTCGTCTTCGTCAGCTCAAAATGTTGGCGGAAGCAATGCCGGCGGCGGATTTGAGACGGCGCTGGCAGCTCGCGCTCTAAGAAAGCAG
CGGGCTCAGCTAGATCGCACTCGTTCCGGTGCTCACAAAGCACTGCGCGGTCTGCGATTCATCAGCAGCAAATCAAATAATGGCGTTGATGCGTGGAACGAGGTGCAGAGCAACTTCAAT
AGGCTCGCCAAGGACGGTTATCTCCATCGCTCCGATTTTGCTCAGTGCATAG
GTTCGTATCTTTTTCAAAATTCTGTTCAGGTTATTGCAAATTTGTAATGTTCCTTTAACAGTTTGATT
CGTTATCCTCAAGTGTTTTCCCTCAACGTTTATTGTATTAAGTTTTTTTTTTATTATTTATTTACGGTTGCAACTTGCAATTATTTAGATCTCACATCCTCTGTCATTTGAATTTTGATA
TTGTGCGCTTCAAGGTTGTTATGCTTTTCTATGCAGGAATGAGAGATTCCAAGGAATTCGCTCTGGAATTATTTGATGCTCTAAGCCGGAAGCGAAGGTTGACGGTTGAGAAGATAAGCA
GGGATGAACTTTTTGAATATTGGACGCAAATTACCGATCAAAGCTTTGATTCGCGACTTCAGATCTTCTTCGACAT
GTAATCATTGAGTGATTATTGCAGTCCAACTTAATTAATAATGA
TTACTAATATTAATATTTCAATGCTTTTCAATTACTTTCCTTTCTTTAATGAAAAGTTTGCAAGTCCTAATTAATTTATGTCATAATAAACACATTGTTAAATATTAGCATGTCACCATA
TATTTGCATTGACACTTAAATATTCGTAAAAAATCTTTGATGCTTTCTTAGCTTGTAATTCAATTACTTTTTTAGATCATCAATTGTTTTGCTTTCTTTTTTTTTTTGGGCATCAAACGT
TTACTTCAATTATTATGGTTTTATATAACGTGACTTAGTATTTTAAAAATTTTATTAATCAAACAGGGTGGATAAAAACGAAGATGGAAGAATCACCGAAGAAGAAGTAAAAGAGGTATA
GAAGACTTTTATTTTATATTACAAACCAAAATGTTCTCTCTCATTTTTGTATTAAACTGAATTTATTTTCTTTTCTGTCTATTTAATTTAGCAATAATCATTCTTCAATATTCAGAGTTT
AAAATTCAAGGTTTAAACTTATAACTCTATTTTATATTATGAAGTGTGATTCCAAATTATGAATTCAACTGTGTCACTGCTTAATTGTTTATCCATTTAATAACCATGTATTCTACGAGT
ATAACATAAGTATTCTCTTTTCGTTGTAGATTATTTATTTTGTTATATTATTAATTCGTCTCTAGCATGGCGTCCACTTGATCTTCAATTAATCAACGTTAGGCAGGATTGGGTAAACTT
AATCGCATGATTATTAAATGAACTACTTCTAATATTCAGTATTTCCACTCATGACGTTTTCCATATTCTAGAAACTCAAGCATAATAATATTAGTTGGTATATTTCAAGAGTCAGTGAAC
TATATACGTCTTACTTTTTCGGCTTTGGTTATACAGATGGCGCTTTCATTTTTCTTATTTTACCAAATTCATAGAATTTATAATGGAGACGTTTTCAGTGGAGTAGTTGGTGGGGGCGTA
GTCGTCATTTTGTGCTGAACTTTTCTTTTGGCCTTTTTTTTTTTAATCAAACATGTAATACTCAATTAAAGCTTTTACATTAAGCTTTTTCGTTGGCCAATTCCTTTTTTTTTCTTATTA
ATTTCCAGATCATCATGTTGAGTGCTTCAGCAAATAAGTTATCGAGATTAAAAGAGCAGGCTGAAGAATATGCCGCTCTGATCATGGAAGAATTAGACCCAGAAGGGCTTGGTTACATCG
AG
GTAGGAAATCGCACTATATTAGATAGATAATATTATTTCTGACTTTATCAACCCGCACTACTCTAATATAGCCGTACATATTTTACAGTTATCTACATAGATACTCTACCTTTAGTAG
TGTTAGCGTGTTAGTACGACGTGAATTACGATAATGCAGCTTAGATTAGTCAGTTTCGAATTAGGACAACCACACCTGTCTTCGGTCAAAATTTGGCCCAAATAGTGTTATTTGAAAATA
ATTCAGAATATTTTTAATGCTGTTCAACCATGCAGGAAAGAAGGGAGATGAAGAAAGAAAATAAACTGTGATAATTAATAATACAAATTATCTTGCCTTCAAAGAAAAATGATTTGATGT
CATAGCAACTCATTGCATCATATATTGAATAATTTAATAGTGTATATAATAAGATCTTGTTTCTATCCTTTTGCTGCGTCAAACTTACCTAAAATCAGGTAGAGAAAACTTGGTCATAGT
GTACGTGACACAATCGCAATTAACTTGTTATTCCTATTAAGGTAGTTCCTCGCCGCAGGTAGTGATGCCGTATAATGTGACTTATTACCATAGCTTAGAGTAACCTTATTTCTTTATCAC
TTGACTTTTCTTCATAAGATATTCACACTTTTTTTTGTCTTTTAATAAAGAATCATTTATATGTTTTGAATAGAGGTCATTGAATAATTATTAATTTTCTGCTAATTATTTGTCAAATGT
TGAATTATTAATTTCATGAAGTATGTTTTTGAAGGTGCATGTGAGGAAGAGAAATGTCATTTTTAGAAGAAATAAAAGAAGAAAAATGACCCAAGTTGACTACTAAATAATTTGGTTCTA
TATACCTTTTCATAATTATTGTGCATCTTGGTGTTTTTCTTTTTATATGTTTTTGGAAGAAGATTTACTTTAAATAGAAACTTACTATCAAAGCTCAAAAGTTCCAACGGATTATACTAA
ATGTTTTTTAATTATCAAAACTCAAAAGGTTATTATTATTTTTTAAAATTTAACAATATTAAACATATTGTTTAGTATATTTAAGATAATATTCAAAAGGATTTTTAATTTGTTGGTTGA
TGTCTCTGCATTATTGAATATGGGCACTATGCTTCTTTTCTCAAGTGGCTTTTCTGCTGCTTGGCCAGTTACGCGTACACATTACTCAAAGTGTAAGTGCGCGTGCTGCATCCTTTTGCT
GTTGTGATGCTGATAATGAAGGGAATGTAGGAATCACTGGCATTATTTCTTTTGCATGATTGAATCTCTAATTGTTTTGGGGCAACTTGGATTGTCATCATCTGTCCCCGCAGCTATGGC
AATTGGAGACGCTTCTTTTGCAGAAGGACACGTACCTTAACTACAGCCAAGCCCTAAGCTACACAAGCCAAGCTTTGAGCCAGAACCTTCAGGGACTAAGGGCAAGAAGTCCTATTCGTA
GGGCGAGCCGCAGGTTGGTCTACTATTTGCAAGAGAATTGGAGGAGACTTTGGCTCTTAACATTGTGGGTTTGCATAATGATTGGGCTGTTCACATGGAAGTTCTTTCAGTATAAGCAGA
AAGATGCCTTTCAAATAATGGGTTACTGTCTTCTAACGGCCAAAGGTGCCGCTGAGACTTTAAAGTTCAACATGGCAATTATACTATTGCCCGTATGTAGAAATACCATTACTTGGCTTA
GGTCTACCAAGCTGGCTTATGCTGTACCTTTTGACGACAACATTAACTTTCATAAG
GTACGCATTGTATATATGATCGCCTTTAGAATTTCCAACACTTAATTCCAGGAATTCAAAACAA
AACAACTAGACATGATATGTATATTGGGGTCCGCTATTTTTCTTCAAATTCATTTATCTATACTTGCAGACAATTGCTGCGGCCATTGTGGTTGGTGTTATACTTCATGCCGGGGATCAC
CTTGCATGCGATTTTCCAAGACTTGTAAGAGCTTCTGAGGCTGATTACGAGAAGTATTTGAAGGGTGTATTTGGTGATCATAAACCCAGTTACCTAGACATTGTGAAAGGGATTGAGGGT
GTGACTGGAATATTGATGGTGATTTTAATGTCAATAGCATTTACACTTGCAACTAAATGGTTCAGGAGAAATCTGATTAAGCTGCCTAAACCATTTAGTAGGCTTACTGGCTTTAATGCC
TTCTGGTATTCACACCATCTGTTTGTCATTGTTTATGTCCTGCTCATCATCCATGGTATAAAGCTTTACCTTGTGCACAAATGGTACCTCAAAACG
GTATGCAAATCAGATTTCGGTTAT
TAGGAATCTTAGTTAAATAAATTGTTCTTCGGCGATTGCTAACTTGACGCATCAATTTCTTTGTGCAGACATGGATGTATCTTTCAATTCCAGTTTTACTTTATGCGGCAGAAAGAACAA
TCAGATTCTTCCGTTCTGGTTTCTATACTGTCCGTCTTATAAAG
GTGAGTACAGAGCAGATGAGGTGGAAACATGTGCAAGGCGCTTAAAATGGGCTTTTAACTTCATCATAAACATAGC
TTTATTGAGTAGCTCTCAGCTTATATTACCTTTTTGACATTGTGAAAAACTTCTATTTAGGTCGCCATATATCCTGGAAATGTTCTAACATTGCAAATGTCTAAGCCTCCCCAATTCCGA
TACAAGAGTGGACAATACATGTTTGTACAATGTCCCGCTGTTTCTCCGTTTGAATG
GTAAGTTGCATTTCAGTTTTTCTTGCTTCTTTTTCTTATATTTAAGTATATATAAAACAGAGCG
CAACAGGGTATTGATTGAATTATGAAAGGCAGTGAAAGTGAACCACTAAAGTGATATGGCATTTTTATGAGTAGTTAGTTACAGTCTTGGTTATGCTTCTTTGCGTGATGTGACGGTAAC
ATGGATCAATATATGTATGACAGGCATCCATTTTCTATTACCTCATCCCCTGGCGATGACTACCTGAGTGTTCACATTCGGCAATTGGGTGATTGGACACAGGAGCTTAAAAGGGTATTT
GCTGAAGCATGTGAGCCCCCTGTATCCGGAAAAAGTGGCCTTCTCAGGGCTGATGAAACAACCAAGAAAAG
GTAAGTGTTGCACTTGCCATTTATTTTTGCCTTCTCGTTTTGATTCTCA
GGACAAATAATTTATGTTTGTTTGTTATTAACAATGGATACAGTCTTCCAAAGCTAAAGATAGATGGACCTTATGGTGCGCCAGCTCAAGATTATAGAAAATACGATGTTTTGTTACTTG
TCGGTCTCGGAATAGGGGCAACACCTTTCATCAGCATTCTGAAAGATCTTCTAAACAACATCATCAAAATGGAGGAGCAGGCG
GTGAGTGTTTGTGCTACACAGGAAAATAGTTACGGTG
TTTATTTATGTAGTCATTTTATATTTTATATAAAACAAATTGAACTGTTATGCCATCCGTTTGCAATTGTCTGGAAATTCATTTCTGACTAAACTGACTATCATGATTACTTCTGTCCAG

GATTCAGTCTCTGATATAAGTAGAGGTTCAGACCAAAGTGTTGGGAGTACAGATTCACCATCTCTAAACAAAATTGCTCCAAAACGGAAGAAAACATTGAAGACTACCAACGCTTATTTC
TACTGGGTTACAAGAGAGCAGGGTTCTTTTGATTGGTTTAAAGGAGTCATGAATGAAGTAGCTGAACTTGATCAACGG
GTAATGATTAATGCAGAGGATTTATTTATTCTACCGAGGAAT
TATCTTTATCAGAATTTGTTTCCTTGGCGCCACATGATTAAGAACTAGTGATGTTGAACTACAGGGTGTCATTGAGATGCACAATTACTTGACTAGTGTATACGAGGAAGGTGATGCAAG
ATCTGCCCTCATTACCATGGTGCAAGCACTCAACCATGCCAAAAACGGTGTTGATATCGTCTCAGGGACTAGG
GTAAGCCTTCTAAATTTTATTATTTGTTCTCTTGTTGCCGTTCAATT
TCTTTATTGGGAGTGAGTAATTCTAAAACATCGATTCGCTTCTTCAAATTTCTATCGTCAGGTGCGAACCCATTTTGCTAGGCCAAACTGGAAGAAGGTTTTCTCCAAAATGTGTTCCAA
GCACTATGGCGGACGAATAG
GTCAGTTTGTCTCCAACAAGCATGCATTGCAAATGCACTTTGTTTATTCTTTTCTCTTTTACTGATATTATGCTTATCTTAATTCTGATCTCTATCAGGG
GTATTTTATTGCGGTGCACCAGTTTTGGCAAAAGAACTTAACAAGCTCTGCTTCGAGTTCAATGAAAAAGGTCCAACAAAATTTGAGTTTCATAAGGAACACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACGGTCATCCGAAGCACCAGCGCAGGTGGGCATCCGACACCGTTCCCGCCAGAGCAACCGTCAGTGCAGGAACTTCGCCGGGAACAGAGTCAACCTCCGCCGGCGGAGAAGAGTTT
GTGGAGGTCACTCTCGATCTTCAAGACGATGACACTATCGTCCTTCGGAGCGTTGAACCAGCCACTGTCATTAACGTTGTTGTTGACAGTGGTACCACTGGTGGCAGTGGACACGAAACT
CCGGCGTCTATTTCTAGGTCGCCGACGATCCGGCGGACCTCGTCGAGAGGCTTGCGGCAGTTCTCGCAGGAGCTGAAGGCGGAGGCGGTTGCAAAGGCAAAGCAGTTCTCGCATGAGCTT
AAGGCAGAGCTGCGACGGTTCTCGTGGAGCCGTTCGTCTTCGTCAGCTCAAAATGTTGGCGGAAGCAATGCCGGCGGCGGATTTGAGACGGCGCTGGCAGCTCGCGCTCTAAGAAAGCAG
CGGGCTCAGCTAGATCGCACTCGTTCCGGTGCTCACAAAGCACTGCGCGGTCTGCGATTCATCAGCAGCAAATCAAATAATGGCGTTGATGCGTGGAACGAGGTGCAGAGCAACTTCAAT
AGGCTCGCCAAGGACGGTTATCTCCATCGCTCCGATTTTGCTCAGTGCATAG
GAATGAGAGATTCCAAGGAATTCGCTCTGGAATTATTTGATGCTCTAAGCCGGAAGCGAAGGTTGACG
GTTGAGAAGATAAGCAGGGATGAACTTTTTGAATATTGGACGCAAATTACCGATCAAAGCTTTGATTCGCGACTTCAGATCTTCTTCGACAT
GGTGGATAAAAACGAAGATGGAAGAATC
ACCGAAGAAGAAGTAAAAGAG
ATCATCATGTTGAGTGCTTCAGCAAATAAGTTATCGAGATTAAAAGAGCAGGCTGAAGAATATGCCGCTCTGATCATGGAAGAATTAGACCCAGAAGGG
CTTGGTTACATCGAG
CTATGGCAATTGGAGACGCTTCTTTTGCAGAAGGACACGTACCTTAACTACAGCCAAGCCCTAAGCTACACAAGCCAAGCTTTGAGCCAGAACCTTCAGGGACTA
AGGGCAAGAAGTCCTATTCGTAGGGCGAGCCGCAGGTTGGTCTACTATTTGCAAGAGAATTGGAGGAGACTTTGGCTCTTAACATTGTGGGTTTGCATAATGATTGGGCTGTTCACATGG
AAGTTCTTTCAGTATAAGCAGAAAGATGCCTTTCAAATAATGGGTTACTGTCTTCTAACGGCCAAAGGTGCCGCTGAGACTTTAAAGTTCAACATGGCAATTATACTATTGCCCGTATGT
AGAAATACCATTACTTGGCTTAGGTCTACCAAGCTGGCTTATGCTGTACCTTTTGACGACAACATTAACTTTCATAAG
ACAATTGCTGCGGCCATTGTGGTTGGTGTTATACTTCATGCC
GGGGATCACCTTGCATGCGATTTTCCAAGACTTGTAAGAGCTTCTGAGGCTGATTACGAGAAGTATTTGAAGGGTGTATTTGGTGATCATAAACCCAGTTACCTAGACATTGTGAAAGGG
ATTGAGGGTGTGACTGGAATATTGATGGTGATTTTAATGTCAATAGCATTTACACTTGCAACTAAATGGTTCAGGAGAAATCTGATTAAGCTGCCTAAACCATTTAGTAGGCTTACTGGC
TTTAATGCCTTCTGGTATTCACACCATCTGTTTGTCATTGTTTATGTCCTGCTCATCATCCATGGTATAAAGCTTTACCTTGTGCACAAATGGTACCTCAAAACG
ACATGGATGTATCTT
TCAATTCCAGTTTTACTTTATGCGGCAGAAAGAACAATCAGATTCTTCCGTTCTGGTTTCTATACTGTCCGTCTTATAAAG
GTCGCCATATATCCTGGAAATGTTCTAACATTGCAAATG
TCTAAGCCTCCCCAATTCCGATACAAGAGTGGACAATACATGTTTGTACAATGTCCCGCTGTTTCTCCGTTTGAATG
GCATCCATTTTCTATTACCTCATCCCCTGGCGATGACTACCTG
AGTGTTCACATTCGGCAATTGGGTGATTGGACACAGGAGCTTAAAAGGGTATTTGCTGAAGCATGTGAGCCCCCTGTATCCGGAAAAAGTGGCCTTCTCAGGGCTGATGAAACAACCAAG
AAAAG
TCTTCCAAAGCTAAAGATAGATGGACCTTATGGTGCGCCAGCTCAAGATTATAGAAAATACGATGTTTTGTTACTTGTCGGTCTCGGAATAGGGGCAACACCTTTCATCAGCATT
CTGAAAGATCTTCTAAACAACATCATCAAAATGGAGGAGCAGGCG
GATTCAGTCTCTGATATAAGTAGAGGTTCAGACCAAAGTGTTGGGAGTACAGATTCACCATCTCTAAACAAAATT
GCTCCAAAACGGAAGAAAACATTGAAGACTACCAACGCTTATTTCTACTGGGTTACAAGAGAGCAGGGTTCTTTTGATTGGTTTAAAGGAGTCATGAATGAAGTAGCTGAACTTGATCAA
CGG
GGTGTCATTGAGATGCACAATTACTTGACTAGTGTATACGAGGAAGGTGATGCAAGATCTGCCCTCATTACCATGGTGCAAGCACTCAACCATGCCAAAAACGGTGTTGATATCGTC
TCAGGGACTAGG
GTGCGAACCCATTTTGCTAGGCCAAACTGGAAGAAGGTTTTCTCCAAAATGTGTTCCAAGCACTATGGCGGACGAATAGGGGTATTTTATTGCGGTGCACCAGTTTTG
GCAAAAGAACTTAACAAGCTCTGCTTCGAGTTCAATGAAAAAGGTCCAACAAAATTTGAGTTTCATAAGGAACACTTCTAA

Retrieve as FASTA