Entry information : AdurRboh08(aradu.Aradu.TQ7E6.1)
Entry ID 16308
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-17 (Christophe Dunand)
Peroxidase information: AdurRboh08(aradu.Aradu.TQ7E6.1)
Name AdurRboh08(aradu.Aradu.TQ7E6.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh003]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis duranensis    [TaxId: 130453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdurRboh08
start..stop
S start..stop
AipaRboh01 1587 0 1..830 1..838
NschRboh09 1181 0 71..830 44..813
CausRboh09 1164 0 60..830 39..812
GmRboh04 1159 0 81..830 53..820
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 400..850 451 N° 2 1895..2051 157 N° 3 2306..2354 49 N° 4 2569..2682 114
N° 5 3443..3865 423 N° 6 3990..3993 4 N° 7 4294..4637 344 N° 8 4718..4813 96
N° 9 5359..5474 116 N° 10 5555..5657 103 N° 11 6375..6554 180 N° 12 6677..6811 135
N° 13 7022..7153 132 N° 14 7305..7383 79 N° 15 9188..9297 110  
join(400..850,1895..2051,2306..2354,2569..2682,3443..3865,3990..3993,4294..4637, 4718..4813,5359..5474,5555..5657,6375..6554,6677..6811,7022..7153,7305..7383,918 8..9297)


exon

Literature and cross-references AdurRboh08(aradu.Aradu.TQ7E6.1)
Cluster/Prediction ref. Genebank:   107470897
Protein sequence: AdurRboh08(aradu.Aradu.TQ7E6.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   830
PWM (Da):   %s   94612.84  
PI (pH):   %s   9.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDDVHHVQVESKAPPHHHHNHDSHHRSSLIALMRASPSSSLTPSSSTSSSSSSSSSSSSWTLKKYLLYDHPGPTGSNNVPPHDDEDHQEHQLRPPHVAEIQELQKRVFIDGIVGHSGMQWNHVNSRFDQVSSTRTSPEPVVEWSNFAFCIGMQSSPEFANELLRALRGGKDWKFNITKTDLYRFWLRIKDDSFDSRMRIFFYMCNRNNDGRITKTDVKTIVLATSTNKLSVTQEEAENSAALIMESLDLQNKGYIQISEMECLLKLIQSPSKKSLAAGDTEKQNNVESNKNGFLEEQEAMSRAEVLFRTNWRRAWMVLVWVMACIVLFGWKFYQYSHRSGFQVMGYCLPTAKGAAETLKLNMALILLPVCRNTITWLRKDPRINYLIPFNDNINFHKASTHLACDFPRISGSSTAVFQQTIAARFGFRQPTYLQILATTEVASGIAMVFLMAIAFTLATKWPRRRSPALPVSLRRVTGYNTFWYSHHLFVIVYALLIVHSMFLFLTNKWTEKTWMYIAFPVLLYTGERIFRAVRSGSYEVDIFKVSLCPGKVLYLKMQKPEGFKYQSGMYIFLQCPQISSLEWHPFSLTSGPQDDYLSVHIRTLGDWSYQIYDLFQAVLTRSEVCPKVYIDGPYGSASQDHVKYDIVVLIGLGIGATPFISILKDVAATTHNDHVHSGVREYGNLTKCPQKAYLYWVTREQNSLDWFRDVMNQIATSNRNQSVVEMHNFLTSTVYPAGDIRAALLSVIQGLHHAKNGTDLVSRSPIYTHFARPNWFNIFARLAQRHRGAKIGVFYCGSSNLARELKKLCTKFSTKTTTRFVFHKENY

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGATGTTCATCATGTTCAAGTAGAATCAAAAGCTCCTCCTCATCATCATCATAATCATGATAGTCATCATCGTTCTTCTCTCATTGCTCTCATGAGAGCATCACCATCTTCTTCA
TTGACTCCCTCCTCTTCCACCTCATCATCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGGACCCTTAAGAAATACCTCCTCTACGACCACCCGGGTCCGACCGGGTCCAATAATGTTCCT
CCTCATGATGATGAAGATCATCAAGAACACCAACTACGACCACCACACGTGGCAGAAATCCAAGAACTTCAGAAAAGAGTGTTCATCGATGGCATTGTCGGTCACAGTGGGATGCAATGG
AACCATGTGAACAGCCGGTTCGACCAAGTTTCCTCGACCAGAACCAGCCCTGAACCGGTTGTAGAATGGTCCAACTTTGCCTTCTGCATTG
GTGAGAAAAATTGTTTTGGTATAACTAAT
TTTTTTTATTTTTAAATATTTATAAATTTTGTCGGTAAAATTTAAGTGCTTTTATTTTAGTTTTTATAGTTAATTTATTCTATTATATGCTAATATAATATATTAAATGAAGAAATTAAA
AAATAATAATTTTAATTTATATTGACTAATATTTATAGCTAGCAGATTCAATATTTTTAGTTTATAATATTATATGTTTAATTAATATTTTTAAATATTACAAATTAATTGGTCAAAAAT
AATAAATGATTATAAGCATGTAGTACAAATGTACAATTCTATCAAATATTAATATTTTACATTTTGCTACATTAGTATTTAATAAAATAAATAATATCAGAGACAAAAATAAATCATTTT
TAAATGTTAATAGATGAAACTAATTTTTTAATATGAACAAAAAAGTTATTTAATTTAGTGTTTTAAACAAATAAATTTTTAATCTACTTGTTACTTTACTATCATAAGATAAATATGAGA
ACAAGACACTTAATATAAAAAAAATATTCGCATAGATATTTTTTTATAAGAAACAGAAAGTCAAACATTTCTTTTTATTATTATGTGTAATTTATAATATTTCATTAACCACTTTATTGA
GTTGTTTTCATTATCTTTAATCATAAAAATTATTATGGGATGCATGATTCTTACGAAACGACACCGTTTTGTGTGCCTTAAATTTCGGTGGCTGCTTTTGTTTGCCTTATAGTACCAATC
AACTAACACACAAGAATCATAGGGTGAGCAAAGCATAGTAGTTAGCCACCTTAGCCACGTTCTTCGCATATGCTACAATGTCTTACATTACAACACAGTTTGTATAATCAATTACTTGTT
CATTAATTCGATTCAGTTATCAATGTTTAACATTTATTTAATTTTGAATCCTCCACTTGGGTTTGTTTTAATTTAAAGGTAATGCTTTTATTTAAACCAACTTAATCTGATTTTGAAAGT
TGTTTGTCTCTGATTCTTTTGCCAATCATTATTGTTATTGTTCATTTTTCAATAGGGATGCAGTCTTCACCAGAATTTGCCAATGAATTGCTAAGAGCATTAAGAGGAGGAAAGGATTGG
AAATTCAACATCACTAAAACTGATTTGTACCGTTTCTGGCTTCGGATTAAAGATGATTCTTTTGATTCAAGAATGCGAATTTTTTTTTACAT
GTAAAAAATTTACACTAAATTATCATAT
TCGTATCTTCAACTATACTAAAAACTAGCTATTAAAATCAGTCGTCAATATAAAATATATGTTAAAATACAAAATATATATTGAAAATAAGTTAAATAATACATGTATTTATACACAAAT
ATATAATGACTGATTTTAGTAGCTGAATTTAGTATACACATAGCATTTTTGCCGCACCTTAACAAGTTTATTTTACTGTTGACTGTAATTTTTTCTTTTACTATAGGTGTAACAGAAACA
ATGATGGAAGAATTACCAAGACAGATGTAAAACAG
GTTAATTAATAATTAATCTTAAGATGATTGAAGAAAAATCATGTTACTATTTGTCATGTTCTGAATGTTGATGTTAGATTTATGG
CACCTAGTCCTACCGGGACAAGTGTATGATTAGTTAAATATAGTAGGTGTGTAAAAAACAGTTAATTGGTTTTGGTAAGCATGGGCATGTTCTTTGTATTTTTGACTAATAATTTTGGCG
CTTGTGTAGACAATTGTATTGGCTACATCTACAAATAAGTTATCCGTGACACAAGAAGAAGCCGAGAACTCTGCAGCTTTGATCATGGAATCACTTGACCTCCAAAACAAAGGCTACATT
CAG
GTACTAATTTTAATCGAATAAAAATCACATGTTTAACTCTTAAAATTTTAAAGGTTTAGCTAGCTTTGTGTCTTTTTTTTTAAGAGTTTAGTTAACATGTATTTTCAAAGTACATTT
AGTAGAAGATTTTAAGTTTTTACAAAATAAATAATTAAATAATAAATGCGAGTTAAGCTCCAAAGTAGTTTTTGAAATTAATTGGGAGAGTGTTAGGTAAACAATGACCATCTTGAACAA
CATAAACAATCACCAATTAAATAAAAATACAGTACATTCTAATTTAATGCTACTAATTAAATTTAAAATTAATTTATTCTTTTAACTCTATTAATTCACATTGTTCACACGTTATTCAAA
AATGTTATTGGTTACTCATACTTTTCCAATTGATTGTATGTATAAAAATAGTTTCTAAGATTTCAATTACATTAATTACATATTTAAGATTGACAAAAATATACTATATAAGTCTCTGAA
CTCTTTTTAATCAAGTGATTCATCACGTGGTTAAAGATTAACGTGGTACACTTTTGACAATTTCAAAAATATAATTGATGTAATTAGAATCTCGGAAACTATTTAAATGCAAATAATCAA
TGTCGGGATTACTTTAGAGCTAAATTTTGTATTTTTCTTAATACAAAATTTTAATTGGTAACATTAACATGTGTCTAAGAACAAGTATTAGCTAAACTCAAGATTTAAATATTGATAATT
CAAGAGACACATTATTCATTAGGCATTGTTTTTTGTTTTCTAGATATCTGAAATGGAGTGTCTGTTGAAGTTAATCCAAAGTCCATCAAAGAAATCATTAGCAGCAGGAGATACAGAGAA
GCAAAATAATGTGGAGAGCAACAAGAATGGGTTCCTTGAGGAGCAAGAAGCAATGTCGAGGGCGGAAGTGTTGTTCCGAACGAACTGGCGGCGAGCTTGGATGGTTCTGGTTTGGGTAAT
GGCTTGCATTGTGCTGTTTGGGTGGAAATTCTATCAGTACAGTCATAGATCAGGATTTCAAGTGATGGGTTATTGCCTTCCAACTGCAAAAGGTGCAGCTGAAACATTGAAACTCAACAT
GGCTCTCATTCTCCTCCCTGTTTGTAGAAACACAATCACTTGGCTCCGCAAGGATCCTAGGATCAACTATCTCATTCCTTTTAATGACAACATTAACTTCCACAAG
GTACACCCTCATCT
AATTTTGCCTGCATTTCGGTTAATTAATTGTCCACTCTGAACAACATGGTACATTTTGTGTCTAGGCTCTATACATTAGGACTACTTTTAAAACTTATTGCAAATATTAGGCTAGTTTGT
TTGTTTACTATCCCAAAATTCACATATATACACATAAATATATGCATTTTGTTTGTTATTAAGATACTAATAAAGAGACATAAATAAATTTGTCATAAAAAACAAATTTACTACTAATAA
GGAAAAAATTGTTAGTAAAATATGCGTGTTATGTGTAATATCTGCATCTTAATCTTTTGACAAAATACTAAATACATGTATTTTGTGTGTTGTTGTAGTCAATATGTTCTTATTTTACTA
AATAAACAGTGAATATGTATCACTGTAATTCATATCTCGGATAGATATAAACAGGTACACACCTTGCCTGTGATTTCCCAAGAATCAGCGGCTCAAGCACGGCGGTTTTCCAGCAGACTA
TAGCGGCGAGATTCGGGTTCCGGCAGCCAACGTACTTGCAAATTTTGGCCACAACAGAGGTGGCAAGTGGGATAGCCATGGTGTTTCTAATGGCCATTGCATTCACACTTGCAACAAAGT
GGCCGAGACGTCGCTCGCCGGCGCTGCCGGTGTCCCTAAGAAGAGTCACCGGCTACAACACATTTTGGTACTCACACCATTTGTTTGTTATTGTCTATGCATTGCTCATTGTCCACTCCA
TGTTCTTGTTCCTAACTAACAAATGGACCGAGAAAACG
GTTAGTCTTTTCTGTCTTTCAACAAATTTTGATACAAAATTATTTTTTTTTCTCACTGATAATTTCTTTTATACGTGCAGAC
TTGGATGTACATTGCTTTTCCAGTTTTGTTATACACTGGAGAGAGGATCTTTAGAGCTGTAAGGTCAGGATCTTATGAAGTTGATATCTTCAAG
GTAGTATTTGATCAACTTTTTTAGCA
ATAGTAGAAACATTGAACTAATTCTCTGTTAACTTTATCATTCTTATGTAACCGTCCAAAATTTGGAAATTTCCAATTTCATTTTTGTTCTTGCAAGTATAATTGAAAATTGAGCAAACC
ATCATTTTTGTCCAAAAAGATTCAACTTAGATAAGGCGACCCATGAAAATAAAATGACATTATGCCTTTCAAAGATTAATTCAGTTCTAAAGTGTCTTGATTTTTTAGAAGCATGTTTAG
TAAAAGGGGAATACTCATATAAAGATGTTTTTATGTTAATAGTCGATAATCGTTGGATAAATTGCCATATTTCACTAAACGGTTTCATATAAGACTAACATCTTAACTAGATATCTCATG
ATTAGCTACCATAGAATGTGATATTTTTATCCTTTCAAATTTTGTTATTTTATGTCAAGTGAATATTTTTAACGGTTTTTTCATGTACAAATAACTTGTCAGATGAAGTTAATCTTCAAG
GGATTATAATGTCATTTAGCTATGATAATTTGCATGCAGGTAAGTCTGTGTCCCGGAAAAGTTTTGTACCTGAAAATGCAAAAACCTGAAGGCTTCAAGTACCAAAGTGGCATGTATATA
TTTCTTCAGTGCCCACAAATTTCATCCCTTGAATG
GTACTTCAATTTCTACAACATTAAACACTGCTACATTTTTAATTCAGTATTAGTCCATTCCAATCTTGCAATACTTGCAGGCATC
CATTTTCCTTAACTTCAGGACCACAAGATGATTACCTTAGTGTGCATATTAGAACTCTTGGAGATTGGAGCTACCAAATATACGACCTATTCCAAGAG
GTACACGTATAAGAAAGTTTTC
AAGTATACCGGTACATCGGTGTTTCAGTAATTTTTAATCGTTGATTTTAATTATGTGCATGTTTGGGCGCCATTATTTTGTTAAAAAAAGATCTTTTTTATTTTTTAACGTGTTTGGCAA
ACTTCTAGTAGTAAAAGTAAAAGTACTAGTAAAATAAAAAAAAGATCTTTTTTGAGAAGCTGTAATTTACATCTTTTTTTAAAAGATCTTTTTTCCTTAAAAAAAATATGTTTTTCATGT
AATAAATAAACAAAAAAAGTACTTTTATATTGTTATACCCAAACATAATTGATAGATAAAAAGACCTTTTTACATGAGATATCCAAACATAAAATTACTTTTGCTTTTCAATAAGATCTT
TTAAAAAAAGATAACTCGAAAAAAATCTTTTTTTAGAAATTCACCCAAACAAGTCCTATAAATATTTTTTATAATTAAGATCAACGGTTAAAAATCACTAAAACACCGCTATACTTGAAA
ATTTTGCACACCTATATATATTGTCAAATGTGATTTTTTTACTATACACTCTTCAGGAAAGACCAGGAGAAAACGTGTCGGTGTCAAAAAAGACGTTGTATAATAAAAGATCACACTTAA
CAACATTACTTAAGAGAAAAATTAAAAAGATTTATTTTCATAAATAATTACAGCATTGAATTTCTAAAAAACAAGGTTGTGGGATATGAATGCAGGCAGTGTTAACAAGATCGGAAGTGT
GTCCAAAAGTGTACATAGATGGGCCATATGGTTCTGCTTCTCAAGATCATGTTAAGTATGATATTGTGGTGCTGATTGGCCTTGGTATTGGAGCCACACCTTTCATTAGCATCCTCAAAG
ATGTAGCAGCTACAACACACAATGATCATGTTCAT
GTAGGCTTTGTTTTTTTTTTTTTTCAAAAAAATATATATAAATTCTACTGTCTATTTTCTTATTACTACACATCTGTAGCTATTC
CATTAAACAAACACCAAAACTTTGGCATTTGAAATAGAGTGGTGTGAGAGAATACGGCAACTTAACAAAGTGTCCGCAAAAGGCATATCTCTATTGGGTCACAAGAGAGCAAAATTCCCT
TGATTGGTTTAGAGATGTTATGAATCAAATTGCAACTTCAAACAGAAATCAG
GTATGTCTAAGTCTAACCACAACCCCATTTAAAAATATCACAAAACCATATTCTCCTGAAAAATGTTT
GACTAACTGGGTTCGCATATAATTGGAATGACTCACGTTCTCACTTAAGGGTGTGAGTCAATACCATATACAATACAAAATGAATATATCTATCATTACTCTTTTTCTGATCCTTGTATT
TTTTTGGTAATCTGTGTTTTAGTCGGTGGTGGAAATGCACAATTTCCTTACTAGTACCGTATATCCTGCCGGAGATATCCGTGCGGCGCTGCTAAGTGTCATTCAGGGGTTGCATCACGC
CAAGAATGGCACTGACTTAGTTTCCAGGAGCCCA
GTAAGTTCATCTTCTTCTTAGTTATATAGGCAATTTATGTCAGCAACAACAATGTAGGAAGAGTGAAATCTCAGATATATCTGAGT
ATTGAGTAAATTAGTATCTTGTTACATGAATTATAGAATAATTTTGTCACTGAATTATTTATCAGATATACACTCATTTTGCTCGTCCGAATTGGTTCAACATATTTGCTAGATTAGCTC
AAAGGCACAGGGGAGCTAAGATTG
GTGAGAATCTCTGTCTCATTCTCTATTTATTAGGGTTTTGCTATCTCAATTAGTCAAATTCTTTACTTATTAGCTCAATGCATTGAATACATCAAA
AACATTAAAAAATTTATTATTATACTAGTATTTTTACTCGTAATAATATTACGGAAATATAGTTTTTTTTTTTAATTACGCTTTACTTCATTCTAAAAGTATAAAGTATAAATTATGCAT
GATACAAAAAATTTATAAAATCAAATTACTTTTATAAAAAAAAAAATCGTAAGTTGACAAAAGTCTCCAACTAAAAAGACTAATATCTCTGTAGATAAAAAAATTAAATAATAAGATTTT
TAGTTATTATTTTTATAAAAAAGTCTAATTTCGATTAATAAGTGATTTTAATATTTTGTTATCTAAACTTTGAAACAATTTAACGTGTATAATTTTACATTTAATTAGTTGTTAAGTGTA
TTGCATAAATAGAAATAATTAATTTTTATACTTCTTATTTAAAAATAATATTTTTTCTCTATGTATATAAAAATATAATTAGATATTAGCGTAAAAAAATTATATTGCTAGTTATAAAAT
TAACTCAAAATTAATTTTTTTAAATAATTAAATATTGATTCTAACTTTTAATTATAACATTAGTATTCTCTCCAAATTATATATAATAAATATTTGAAAGAAGAGAAATGAAAATATAAA
TTAGAAAGATAAGCGGTAAAAATTTAAAACTAAATAAAAAATTAAAAAAATAAGTATATAATAATATTATTTTTTATTTGAATTATATTATTTTGTTAATTTTATTTTTTTGTGGAAAGG
TAGAAAAAATAGAAAATGAGAGAAAAGAGAGAGAAAGATAAAGATGAAGAATGAGAATGAAAGTGAGAATTTGTTAATTTTAGAAGAAAAAATTATTTTAATTGTAATAAAAAATATCGG
ATGACATATTTTGATTTGTTAAATTACTAATTTAAAATATAAAATATATATAGAGTGAAAATAGTAGAGAGAAATAGAAAAATGGAGAAAGGTAGATGAGATAATTTATGAAGAAAATTT
ATTAATTTTGGAGAAAAATATTTTTCTCAGTTTTAATAAGAGAGTGTCATGTGATATATTTGATTATTAAATTAGATAGTAATATATGATAGTAATTTATGATACATAACATAAGTATAT
TTCAATTTTATTTTAATACAATTAAGGAATGTCATGTTGCACATTTTGATTGTCAAATTAGTAATTAGTCATTGATATTGATAATGATATATAAAAGAGATAAAGTGGTTGAAGGAACGA
AAGAGATAGAGAAAAGAAGAAGGAGGAGGAGAGAACTCTTTAATTTTGGAGAAAAAGATTTGATTTTAATTGTAACGAGAGAGTGACATATGACACATTTTGGTTGTAAAATTAGTAGGG
AGGAAGAAAGAAATCTTTGGTTTTTGAGGGAAAGATTTAATTTCAATTATAATGAGGGAATGACATGTGACACATTTTAGTTGTAAAATTAGTAAAAAAGAGGGGAGAATTCTTTAATTT
TAGAAGAACAGATTTGATTTTAATTGTAATGAAAGAGTGACATATGACATATTTTAGTTGTAAAATTAAAAACATATAATAAAATATATAATAGATTTTAAAAATATACCGGGCACAAGT
TAGTTAAATTCTACTTATAATACCATTCATCACATTGATTATTATCATATATGTAGATAAAATTAAGGAAGGTTTAATAATTGAAATCCATATATTATGTATTTTGCCCAAACTAATGCT
GTTACTAATGTGAGATTTTCTGTTACAGGGGTTTTCTATTGTGGCTCATCTAATTTGGCAAGGGAGTTGAAGAAGTTGTGCACCAAATTTTCCACCAAAACCACAACAAGATTTGTTTTC
CACAAGGAAAATTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGATGTTCATCATGTTCAAGTAGAATCAAAAGCTCCTCCTCATCATCATCATAATCATGATAGTCATCATCGTTCTTCTCTCATTGCTCTCATGAGAGCATCACCATCTTCTTCA
TTGACTCCCTCCTCTTCCACCTCATCATCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGGACCCTTAAGAAATACCTCCTCTACGACCACCCGGGTCCGACCGGGTCCAATAATGTTCCT
CCTCATGATGATGAAGATCATCAAGAACACCAACTACGACCACCACACGTGGCAGAAATCCAAGAACTTCAGAAAAGAGTGTTCATCGATGGCATTGTCGGTCACAGTGGGATGCAATGG
AACCATGTGAACAGCCGGTTCGACCAAGTTTCCTCGACCAGAACCAGCCCTGAACCGGTTGTAGAATGGTCCAACTTTGCCTTCTGCATTG
GGATGCAGTCTTCACCAGAATTTGCCAAT
GAATTGCTAAGAGCATTAAGAGGAGGAAAGGATTGGAAATTCAACATCACTAAAACTGATTTGTACCGTTTCTGGCTTCGGATTAAAGATGATTCTTTTGATTCAAGAATGCGAATTTTT
TTTTACAT
GTGTAACAGAAACAATGATGGAAGAATTACCAAGACAGATGTAAAACAGACAATTGTATTGGCTACATCTACAAATAAGTTATCCGTGACACAAGAAGAAGCCGAGAACTCT
GCAGCTTTGATCATGGAATCACTTGACCTCCAAAACAAAGGCTACATTCAG
ATATCTGAAATGGAGTGTCTGTTGAAGTTAATCCAAAGTCCATCAAAGAAATCATTAGCAGCAGGAGAT
ACAGAGAAGCAAAATAATGTGGAGAGCAACAAGAATGGGTTCCTTGAGGAGCAAGAAGCAATGTCGAGGGCGGAAGTGTTGTTCCGAACGAACTGGCGGCGAGCTTGGATGGTTCTGGTT
TGGGTAATGGCTTGCATTGTGCTGTTTGGGTGGAAATTCTATCAGTACAGTCATAGATCAGGATTTCAAGTGATGGGTTATTGCCTTCCAACTGCAAAAGGTGCAGCTGAAACATTGAAA
CTCAACATGGCTCTCATTCTCCTCCCTGTTTGTAGAAACACAATCACTTGGCTCCGCAAGGATCCTAGGATCAACTATCTCATTCCTTTTAATGACAACATTAACTTCCACAAG
GCTAGT
ACACACCTTGCCTGTGATTTCCCAAGAATCAGCGGCTCAAGCACGGCGGTTTTCCAGCAGACTATAGCGGCGAGATTCGGGTTCCGGCAGCCAACGTACTTGCAAATTTTGGCCACAACA
GAGGTGGCAAGTGGGATAGCCATGGTGTTTCTAATGGCCATTGCATTCACACTTGCAACAAAGTGGCCGAGACGTCGCTCGCCGGCGCTGCCGGTGTCCCTAAGAAGAGTCACCGGCTAC
AACACATTTTGGTACTCACACCATTTGTTTGTTATTGTCTATGCATTGCTCATTGTCCACTCCATGTTCTTGTTCCTAACTAACAAATGGACCGAGAAAACG
ACTTGGATGTACATTGCT
TTTCCAGTTTTGTTATACACTGGAGAGAGGATCTTTAGAGCTGTAAGGTCAGGATCTTATGAAGTTGATATCTTCAAG
GTAAGTCTGTGTCCCGGAAAAGTTTTGTACCTGAAAATGCAA
AAACCTGAAGGCTTCAAGTACCAAAGTGGCATGTATATATTTCTTCAGTGCCCACAAATTTCATCCCTTGAATG
GCATCCATTTTCCTTAACTTCAGGACCACAAGATGATTACCTTAGT
GTGCATATTAGAACTCTTGGAGATTGGAGCTACCAAATATACGACCTATTCCAAGAG
GCAGTGTTAACAAGATCGGAAGTGTGTCCAAAAGTGTACATAGATGGGCCATATGGTTCTGCT
TCTCAAGATCATGTTAAGTATGATATTGTGGTGCTGATTGGCCTTGGTATTGGAGCCACACCTTTCATTAGCATCCTCAAAGATGTAGCAGCTACAACACACAATGATCATGTTCAT
AGT
GGTGTGAGAGAATACGGCAACTTAACAAAGTGTCCGCAAAAGGCATATCTCTATTGGGTCACAAGAGAGCAAAATTCCCTTGATTGGTTTAGAGATGTTATGAATCAAATTGCAACTTCA
AACAGAAATCAG
TCGGTGGTGGAAATGCACAATTTCCTTACTAGTACCGTATATCCTGCCGGAGATATCCGTGCGGCGCTGCTAAGTGTCATTCAGGGGTTGCATCACGCCAAGAATGGC
ACTGACTTAGTTTCCAGGAGCCCA
ATATACACTCATTTTGCTCGTCCGAATTGGTTCAACATATTTGCTAGATTAGCTCAAAGGCACAGGGGAGCTAAGATTGGGGTTTTCTATTGTGGC
TCATCTAATTTGGCAAGGGAGTTGAAGAAGTTGTGCACCAAATTTTCCACCAAAACCACAACAAGATTTGTTTTCCACAAGGAAAATTATTAA

Retrieve as FASTA