Entry information : AipaRboh05(araip.Araip.JFL5M.1)
Entry ID 16337
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-02 (Christophe Dunand)
Peroxidase information: AipaRboh05(araip.Araip.JFL5M.1)
Name AipaRboh05(araip.Araip.JFL5M.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis ipaensis    [TaxId: 130454 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AipaRboh05
start..stop
S start..stop
AdurRboh03 1829 0 1..882 1..882
NschRboh03 1686 0 10..882 13..897
CcajRboh03 1678 0 1..882 1..884
GmRboh02 1670 0 1..882 1..885
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 148..643 496 N° 2 740..899 160 N° 3 2406..2454 49 N° 4 2700..3242 543
N° 5 3450..3836 387 N° 6 3928..4023 96 N° 7 4108..4223 116 N° 8 4309..5000 692
N° 9 5142..5251 110  
join(148..643,740..899,2406..2454,2700..3242,3450..3836,3928..4023,4108..4223,43 09..5000,5142..5251)


exon

Literature and cross-references AipaRboh05(araip.Araip.JFL5M.1)
Protein sequence: AipaRboh05(araip.Araip.JFL5M.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   882
PWM (Da):   %s   100127.6  
PI (pH):   %s   9.47
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIQQEEHESWSETESTGSRSTRVGFSGPLSGPLVSNNKKKLSARFKDDDDDLVEITLDVRDDTVCVQNIRGGDPETALLASRLEKRPSSLGVRLRQVSQELKRMTSSQKFDKVDRSKSGAARALKGLKFITKNVGTDGWSKVESRFLELAVDGKLPKTRFSQCIGMNDSREFAGELFDALARRRGITSASITKDELREFWEQITDQSFDSRLQTFFDMVDKNADGRITEEEVRIIALSASANKLSKLQERAEEYAALIMEELDPDNLGFVEVYNLEMLLLQAPAQSTHMNTDSRVLSQMLSQKLVPTKEHNPIKRGLRSLSYFIEDNWKRLWIVALWLCICAGLFTWKFIQYKNRAVFHVMGYCVTTAKGAAETLKFNMALILLPVCRNTITWLRSRTKLGMAVPFDDNINFHKVIAFGVAIGVGLHAISHLTCDFPRLLHATDAEYEPMKPFFGEHRPNNYWWFVKGTEGWTGIVIVVLMAIAYTLAQPWFRRSRLNLPKPLKKLTGFNAFWYSHHLFVIVYALLIVHGYFLYLSKHWYKKTTWMYLAIPMLIYACERLLRAFRSGYKSVKILKVAVYPGNVLALHMSKPQGFKYYSGQYIFVNCSDVSPFQWHPFSITSAPGDDYVSVHIRTLGDWTSQLKAVFAKACQPASGDQSGLLRADMLQGNNIPRMPKLLIDGAYGAPAQDYKNYEVILLVGLGIGATPLISILKDVLNNIKQQKDIEEGMVESGVKNNKRKPFATNRAYFYWVTREQGSFEWFRGVMDEVAENDKDGVIELHNYCTSVYEEGDARSALITMLQSLQHAKSGVDIVSGTRVKTHFARPNWRKVFKQAALKHPNKTGVFYCGAHALVGELKRLSLDFSRKTNTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTCAGCAAGAGGAACACGAGTCGTGGTCGGAGACGGAGAGCACGGGGAGCCGGAGCACACGTGTGGGCTTCAGTGGGCCGCTGAGCGGCCCATTGGTGTCCAACAACAAGAAG
AAGTTGAGCGCCAGGTTCAAGGACGACGATGATGACTTGGTCGAGATCACCTTGGACGTTCGCGACGACACCGTTTGCGTCCAGAACATTCGAGGCGGAGACCCAGAGACGGCACTCCTC
GCTAGCCGCCTCGAGAAGCGGCCGTCCTCGCTCGGTGTCCGCCTCAGACAGGTGTCACAGGAACTGAAACGCATGACTTCCTCTCAGAAGTTCGACAAAGTTGATAGGAGCAAGTCCGGT
GCCGCACGTGCACTCAAAGGACTCAAGTTTATTACCAAAAATGTCGGAACTGATGGTTGGTCTAAGGTTGAGAGCCGGTTCCTTGAGTTGGCTGTCGATGGAAAGCTCCCCAAAACCCGG
TTTAGCCAGTGCATAG
GTACCTCTTATTTTTATTCTTAATTTTTTAGTCGATCAATGTTACTGTTGTTGGTGAAGTAATTAATTAGTTAATGACGAAAACTAATTAAACTAGGTATGAAC
GACTCGAGGGAGTTTGCTGGAGAGTTATTTGATGCATTAGCTCGTCGTCGAGGCATAACATCGGCTTCCATTACCAAGGATGAGTTGCGTGAATTCTGGGAACAAATTACTGATCAGAGC
TTTGATTCAAGGCTGCAGACCTTCTTTGACAT
GTAAGATAATTATTATGATAGCTTCATTAATTAGGACATGCATGCGATCAATCATCACAGGTAGTATGTATAATTATATTGCATGCAC
ATTAAAAAAAATACATATTAAAATATAAAATATATTTTTAAAATGAATTAAATAAATATGTTCTTATACAAACATATTTGTGACCAATTTGATGAGTAACACCTAACATCTTTTATAATC
AAATGTGGTAGCTATAAGACCTAGGTGTTAATGGAGACTAATTAAGGTGCTCATTCATTTTTTAAAGACCAAACAGATTAATTACAGATTATAGACAATAGAGAGATCGTCATGAAAGAG
CCTAGCAGCGGAAACGACACAAATGTCCAACACAAGAACAATATGGAAGCACTCACAACACAATATGGCAGCAACTATAACAAGCAAATATAGCAAGTAAAGCAGTAATAAGAACACACC
GAGATTTTAACGTGGTTTTAGTATACCAATATAGTATTATCAATTTTGAAATAGTTATTATTCCAAGTATAAGTATGAAAGTATTCTCAATGTTTCTAGGTTTATGTAGTAGAACTAACC
GAAGGGTGCTTATCATTTTTGAAACCTAAAAACTTAACTAAATCACGCAATCATAATAAGCTTATAATTTAATAATTTTTAAAACCTACATATTGTAACCTGTCAAATGGCACCCAATTA
GTAGTTAAAAGATCAGATCACTATTTTTTGGTTGAATTGCTCTATACGAATTATGTTTTTATAAAAAATTACTTAAAAACATTTTGAAGAATTATTTTTCGATCTCCTGTGTACAACTAT
ACATGACGCGGGATTTTAATCCATCATTCAAACCTTAGAAAATTTGTTACAAGATTATTATTGTTATTATTATTAAGATAGTGGAACGGTCTAGGGGTTAAGCTGGAAAGTGAACCAAAA
AGATAAATTGAACTTAAATAGGAAATCAATGGTTGGTCCCATTGAAGAGAAGAAAAAGAAAAAGAATGAATCAGCGTTTGCTGCACCAAACCCAAAGGGCTTTAGGAACAAGAACCAGTC
AACGCTGTGTTGGGTTGATAACTGAACCAAAAAAATATACATACACGGAATTTGTCTCTCTATTGACTATTGAGTATCATTTGGAAAACAACATATGTACGCATGAATGTCACATAAAGA
TATAATTATTTATAAGCTCTCTTCTTATCAGTTTACATTATTAGAATAAATAACATTTTAATATAATTTTAAAGTTTTATATTCAAAAATCTTAAATTCAACTTTTAATAAATTTTAAAA
TTAAAAAAATAATAATATAAGATAAATAAAAAATATATAAAAAAACAAAAATTCAAAAATTCAAAAGAGTACCGTTGAAAATGAGTCCTATATGATGACAATGTCATAGTCAAAATATGA
AAACATATATTATGGAGAACCAAATGTCAATGCTATATCTTAAATTGGGTTTACACCGACATTTTTACTGACTATTGATAAAATTGAACTCATGCCAGGGTGGACAAGAATGCTGACGGA
CGAATTACCGAAGAAGAAGTCAGAGAG
GTATGCAATAATATACGACTATACTTGCTGAAATTATTTTTTAAAAAATATAGGAGTGAGTATTTTTATTAAATTTCGTCACCACTTAATTAG
TAAATAAAAATTAATAATTTTATATTAAAATAAAATTTTATATCATTAAATATATTAATAATGACTAATTAACGACTATAAATCATAAAATTTGTTAGCACATGTGGAGATAGGAAGGTT
GCTAAACTGCTGTATGATTATTGTTTTTACAGATTATCGCTTTGAGCGCTTCCGCTAATAAGCTTTCAAAATTACAAGAGCGTGCGGAAGAATATGCAGCTCTTATCATGGAAGAGTTGG
ATCCAGACAACCTTGGATTCGTTGAGGTTTACAATTTGGAAATGCTGCTTCTGCAAGCACCAGCGCAATCAACACACATGAACACAGATAGCAGGGTGCTGAGCCAAATGCTGAGCCAGA
AACTAGTCCCAACAAAAGAGCACAACCCAATCAAGCGTGGGTTGCGGTCACTGTCCTACTTCATCGAGGACAATTGGAAGCGTCTCTGGATTGTAGCTCTCTGGCTCTGCATTTGCGCAG
GCCTCTTTACTTGGAAGTTCATCCAGTACAAGAACCGCGCAGTCTTCCACGTCATGGGCTACTGTGTCACCACGGCCAAGGGAGCCGCCGAGACTCTCAAGTTCAACATGGCCTTAATCC
TCTTACCTGTATGCAGAAACACCATCACCTGGCTCAGGAGCAGGACCAAGCTAGGCATGGCCGTTCCCTTTGATGACAACATCAACTTTCACAAG
GTATGTATGTCCTTATTTTATATCT
TAAGTTAGTTAGTGTCTCATAAATACAAAATATACTAATTTAATATCTCTAAATACAATGTCTTTATACATGTTTTGTTTGCTAAATACAATTTTATATTTTTATATCCCAATATTCTAT
AAACAAAAACAGCCTTAATATCTTTTCCATAACATAACTATAACTGTGGTGTCTTTGTTCAGGTGATTGCTTTTGGGGTTGCGATTGGGGTTGGGTTGCATGCAATTTCGCATCTAACGT
GCGATTTCCCAAGGCTGTTACACGCGACGGACGCGGAATATGAGCCAATGAAGCCATTTTTTGGGGAGCATAGGCCAAACAATTATTGGTGGTTTGTGAAGGGGACAGAGGGTTGGACAG
GGATAGTGATTGTGGTGCTTATGGCAATAGCATACACATTGGCACAACCTTGGTTCCGAAGAAGCAGGTTGAATCTTCCTAAACCTCTCAAGAAACTCACTGGCTTCAACGCCTTTTGGT
ACTCTCATCACCTCTTCGTCATTGTCTATGCTCTTTTAATCGTTCATGGATACTTCCTTTACCTCAGCAAGCATTGGTATAAGAAAACG
GTATGCATCAATTTATTACATGCATTCACAT
TATTTTCCTTATTCATTCATTCTTTTCTTCTTTTCTAAACTTATTGAACTATTGGCACAGACTTGGATGTATCTTGCTATTCCCATGCTCATATACGCATGTGAGCGCCTACTTCGTGCT
TTTAGATCTGGCTACAAAAGCGTCAAGATTTTGAAG
GTACATTGCCTTGTCTACTACTGCTTTTGTTTAAGATAAATAATGCACTAAAGACTAAACTATATAAACTTGTCAATGTTCCAG

GTTGCAGTATACCCAGGAAATGTCTTGGCCTTGCATATGTCAAAACCACAAGGGTTTAAGTACTATAGCGGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATG
GTAA
AATTCATCTAACGAGAAATGTTTCTCTAAATTAATTGGTATTAGTTAGTTATAACTAACTGACATCTATGTATATGTATAGGCATCCTTTCTCTATTACATCAGCTCCGGGAGATGATTA
CGTAAGCGTCCATATTCGGACTTTGGGTGACTGGACTTCACAGCTTAAGGCGGTTTTCGCGAAGGCGTGTCAACCGGCAAGTGGGGACCAAAGTGGTCTTCTAAGAGCAGATATGTTACA
GGGCAACAACATACCAAGGATGCCGAAGCTCTTGATTGATGGGGCATATGGAGCTCCAGCACAAGACTACAAGAACTACGAAGTGATCCTTCTCGTGGGGCTAGGAATTGGTGCAACACC
ATTGATTAGTATACTGAAAGATGTGTTAAACAACATAAAGCAACAGAAAGACATAGAAGAAGGGATGGTGGAAAGTGGTGTTAAGAACAACAAGAGAAAACCATTCGCCACAAACAGGGC
TTATTTCTACTGGGTGACACGTGAGCAGGGGTCGTTCGAGTGGTTCAGGGGTGTGATGGATGAGGTTGCAGAGAATGACAAGGACGGAGTGATTGAGCTTCATAACTATTGTACAAGTGT
GTATGAAGAAGGAGATGCCAGATCGGCTTTGATCACAATGCTTCAGTCCCTCCAACATGCTAAGAGTGGTGTGGATATTGTTTCAGGGACAAGGGTCAAGACCCACTTTGCTAGGCCTAA
TTGGCGTAAGGTCTTTAAGCAAGCTGCTCTCAAACACCCTAACAAAACAGTTG
GTAAGTTCATTTTCTTAATATCTCTCCTTATATGGAATTTAAATTATACTTTGTTAGGAAATATAAA
AAAAATGAGTTATATAAATACCAAAATCNTATGATTATTATGTTTACATTCTCTATTTACTCCTTTTTTTTTAGGTGTATTTTACTGTGGAGCTCATGCTTTGGTTGGAGAATTAAAGAG
GCTTTCTCTGGACTTTTCTAGGAAAACCAACACTAAGTTCGATTTTCATAAGGAGAATTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTCAGCAAGAGGAACACGAGTCGTGGTCGGAGACGGAGAGCACGGGGAGCCGGAGCACACGTGTGGGCTTCAGTGGGCCGCTGAGCGGCCCATTGGTGTCCAACAACAAGAAG
AAGTTGAGCGCCAGGTTCAAGGACGACGATGATGACTTGGTCGAGATCACCTTGGACGTTCGCGACGACACCGTTTGCGTCCAGAACATTCGAGGCGGAGACCCAGAGACGGCACTCCTC
GCTAGCCGCCTCGAGAAGCGGCCGTCCTCGCTCGGTGTCCGCCTCAGACAGGTGTCACAGGAACTGAAACGCATGACTTCCTCTCAGAAGTTCGACAAAGTTGATAGGAGCAAGTCCGGT
GCCGCACGTGCACTCAAAGGACTCAAGTTTATTACCAAAAATGTCGGAACTGATGGTTGGTCTAAGGTTGAGAGCCGGTTCCTTGAGTTGGCTGTCGATGGAAAGCTCCCCAAAACCCGG
TTTAGCCAGTGCATAG
GTATGAACGACTCGAGGGAGTTTGCTGGAGAGTTATTTGATGCATTAGCTCGTCGTCGAGGCATAACATCGGCTTCCATTACCAAGGATGAGTTGCGTGAATTC
TGGGAACAAATTACTGATCAGAGCTTTGATTCAAGGCTGCAGACCTTCTTTGACAT
GGTGGACAAGAATGCTGACGGACGAATTACCGAAGAAGAAGTCAGAGAGATTATCGCTTTGAGC
GCTTCCGCTAATAAGCTTTCAAAATTACAAGAGCGTGCGGAAGAATATGCAGCTCTTATCATGGAAGAGTTGGATCCAGACAACCTTGGATTCGTTGAGGTTTACAATTTGGAAATGCTG
CTTCTGCAAGCACCAGCGCAATCAACACACATGAACACAGATAGCAGGGTGCTGAGCCAAATGCTGAGCCAGAAACTAGTCCCAACAAAAGAGCACAACCCAATCAAGCGTGGGTTGCGG
TCACTGTCCTACTTCATCGAGGACAATTGGAAGCGTCTCTGGATTGTAGCTCTCTGGCTCTGCATTTGCGCAGGCCTCTTTACTTGGAAGTTCATCCAGTACAAGAACCGCGCAGTCTTC
CACGTCATGGGCTACTGTGTCACCACGGCCAAGGGAGCCGCCGAGACTCTCAAGTTCAACATGGCCTTAATCCTCTTACCTGTATGCAGAAACACCATCACCTGGCTCAGGAGCAGGACC
AAGCTAGGCATGGCCGTTCCCTTTGATGACAACATCAACTTTCACAAG
GTGATTGCTTTTGGGGTTGCGATTGGGGTTGGGTTGCATGCAATTTCGCATCTAACGTGCGATTTCCCAAGG
CTGTTACACGCGACGGACGCGGAATATGAGCCAATGAAGCCATTTTTTGGGGAGCATAGGCCAAACAATTATTGGTGGTTTGTGAAGGGGACAGAGGGTTGGACAGGGATAGTGATTGTG
GTGCTTATGGCAATAGCATACACATTGGCACAACCTTGGTTCCGAAGAAGCAGGTTGAATCTTCCTAAACCTCTCAAGAAACTCACTGGCTTCAACGCCTTTTGGTACTCTCATCACCTC
TTCGTCATTGTCTATGCTCTTTTAATCGTTCATGGATACTTCCTTTACCTCAGCAAGCATTGGTATAAGAAAACG
ACTTGGATGTATCTTGCTATTCCCATGCTCATATACGCATGTGAG
CGCCTACTTCGTGCTTTTAGATCTGGCTACAAAAGCGTCAAGATTTTGAAG
GTTGCAGTATACCCAGGAAATGTCTTGGCCTTGCATATGTCAAAACCACAAGGGTTTAAGTACTATAGC
GGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATG
GCATCCTTTCTCTATTACATCAGCTCCGGGAGATGATTACGTAAGCGTCCATATTCGGACTTTGGGTGACTGG
ACTTCACAGCTTAAGGCGGTTTTCGCGAAGGCGTGTCAACCGGCAAGTGGGGACCAAAGTGGTCTTCTAAGAGCAGATATGTTACAGGGCAACAACATACCAAGGATGCCGAAGCTCTTG
ATTGATGGGGCATATGGAGCTCCAGCACAAGACTACAAGAACTACGAAGTGATCCTTCTCGTGGGGCTAGGAATTGGTGCAACACCATTGATTAGTATACTGAAAGATGTGTTAAACAAC
ATAAAGCAACAGAAAGACATAGAAGAAGGGATGGTGGAAAGTGGTGTTAAGAACAACAAGAGAAAACCATTCGCCACAAACAGGGCTTATTTCTACTGGGTGACACGTGAGCAGGGGTCG
TTCGAGTGGTTCAGGGGTGTGATGGATGAGGTTGCAGAGAATGACAAGGACGGAGTGATTGAGCTTCATAACTATTGTACAAGTGTGTATGAAGAAGGAGATGCCAGATCGGCTTTGATC
ACAATGCTTCAGTCCCTCCAACATGCTAAGAGTGGTGTGGATATTGTTTCAGGGACAAGGGTCAAGACCCACTTTGCTAGGCCTAATTGGCGTAAGGTCTTTAAGCAAGCTGCTCTCAAA
CACCCTAACAAAACAGTTG
GTGTATTTTACTGTGGAGCTCATGCTTTGGTTGGAGAATTAAAGAGGCTTTCTCTGGACTTTTCTAGGAAAACCAACACTAAGTTCGATTTTCATAAGGAG
AATTTTTAG

Retrieve as FASTA