Entry information : CcajRboh01(Cajca_02872)
Entry ID 16342
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-04 (Christophe Dunand)
Peroxidase information: CcajRboh01(Cajca_02872)
Name CcajRboh01(Cajca_02872)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh003]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Cajanus cajan    [TaxId: 3821 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcajRboh01
start..stop
S start..stop
GmRboh04 1479 0 1..818 1..820
PvRboh07 1474 0 1..818 1..823
GmRboh13 1474 0 1..818 1..821
PauRboh09 1466 0 1..818 1..814
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 526..892 367 N° 2 1333..1489 157 N° 3 1594..1642 49 N° 4 1902..2015 114
N° 5 2108..2542 435 N° 6 3238..3624 387 N° 7 4192..4287 96 N° 8 4862..4977 116
N° 9 5108..5210 103 N° 10 5288..5470 183 N° 11 5595..5726 132 N° 12 5857..5985 129
N° 13 6370..6448 79 N° 14 6678..6787 110  
join(526..892,1333..1489,1594..1642,1902..2015,2108..2542,3238..3624,4192..4287, 4862..4977,5108..5210,5288..5470,5595..5726,5857..5985,6370..6448,6678..6787)


exon

Literature and cross-references CcajRboh01(Cajca_02872)
Protein ref. GenPept:   XP_020228075.1   KYP56695.1 [Incorrect prediction]
Cluster/Prediction ref. Genebank:   109809237
Protein sequence: CcajRboh01(Cajca_02872)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   818
PWM (Da):   %s   92294.6  
PI (pH):   %s   9.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDGLLKSQIPLNDRSLIALFKSSPSSSSLSSSSTVKEVLHSSSLVQTRYEVSNDVADLSSEQKQKCSHIIENGAIQGVRFINGIVGQSGMEWKDVENRFDQLGRTGSGAEPVVAWSEFGSCVGMQSSPEFANELLRALRGGKHWKSNITKTDLYNLWFRMKDNSFNSRLRIFFDMCNRNKDGRVTETDIKTILLTASTNKLSVTHDEAEDYASLIMESLDKKKKGYIETSQMGSLFKASLSKAHSPMKQVAATGSSIQNVHKTNGGDFCDEEEEPMSWTEVLFRTYWRRCWVVLLWVLACLGLFVWKFVQYSHRSGFEVMGYCLPTAKGAAETLKLNMALVLLPVCRNTITWLRKHRPINSVIPFNDNINFHKLIAGGIVVGVILHGGTHLACDFPRISESDRSIFRQTIAAGFGYHRPTYVELLATTEVTSGIGMVVLMGVAFPLATKWPRRRSPVLPVSLRRVTGYNTFWYSHHLFVLVYALLIIHSMFLFLTDKLMEKTTWMYIAFPVLLYAGERIFRAIRSGSYEVDILKASLYPGKVLYLKIQKPEGFKFQSGMYIFLQCPQISPFEWHPFSLTSGPRDDYLSVHIRTLGDWSYQIYALFQAVLSRSQGCPKLYIDGPYGSAAQDHVKYDILVLIGLGIGATPFISILKDVVKSVQTTQIDDSGLRKCSLTKGPLKAYLYWVTREPNSFDWFRDVMKEISNSTKKQSVVEMHNFLTSVHPEGDIRSALLSVIQALHFAKNGTDIVSRTPIHTHFARPNWFNIFSRLARKHGGAKIGVFYCGPSKLARELKKLCTKFSTKTTTRFVFHKENY

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGGGCTTCTAAAGTCCCAAATTCCTCTTAATGATCGTTCCCTCATTGCTCTCTTCAAATCATCACCTTCTTCTTCGTCCTTGTCTTCTTCTTCGACCGTCAAAGAAGTCCTTCAT
TCCTCGTCCCTGGTTCAAACCAGGTACGAGGTTTCTAACGATGTAGCAGACTTGAGTTCGGAACAAAAACAAAAATGTTCTCACATAATAGAAAATGGAGCAATTCAAGGTGTGAGGTTC
ATCAATGGCATTGTTGGTCAGAGTGGAATGGAGTGGAAGGATGTGGAGAACCGGTTCGACCAACTTGGTCGAACCGGTTCTGGAGCCGAACCGGTTGTGGCATGGTCCGAATTTGGCTCC
TGCGTTG
GTGAGAATAGGAAACTAAAGTCAGCAGTTCATGCAACATTATCACTTTGTTTCACGACCACAAATACAATAATTCATAATGCATTAATGCATGATGTTCTTTGAGACATTGAT
AAGTCCTTTTCTATGTCTCTTCTGTTTATCATCTGGCACTGGTCAATTAACTCGAGAATCATATCGAGCAGAGTAGTTAGCCACCTTAGCCATGTTCTTCGGATACGCTATAGTGCCGTA
ATATAAGACAACTTGTGTCATTTTTATTATTCATCTCCCTACTTAATTTATTTCAATGATCAATGTTCAACACTTTATTTCTCATTTTTTTAATAATAACAAAAGACCAAATACGTTATC
TATACCTACCTGTTCTTAAATAATTCTGATCTTATTCTGCAAATTATTGTCTTAATTTTTCACTCTCAATTATGTCCTATTTTATAGGGATGCAGTCATCACCCGAGTTTGCCAATGAAT
TGCTAAGAGCGTTGAGAGGAGGCAAGCATTGGAAATCCAATATCACCAAAACTGATTTGTACAATCTTTGGTTTCGGATGAAGGACAATTCTTTTAACTCGAGATTGCGAATCTTCTTTG
ACAT
GTAAAAACCAAAAAAAAAAAAAAGAAGAAAAAAAAAACCTCTGCTAAACTCTCTTATGCACAATTCTGAGATCAAATAATAATTTTTCATTGGCTTTACTTTAGGTGTAACAGAAA
CAAGGACGGAAGAGTCACCGAAACAGATATAAAACAG
GTTATTATTTATTTAATGAAGTTTAATTTATAATTAACTTTACTAGCTAGGGTGTGGTGAGGCTGCTTAAATTTGCATGTGTT
AATTGTCTTGTTCCGCATGTTGGCGTTGATTTTGGCCCTTCTTCCACAGAAAAACTCTATGATGTGTGGTTCCATAATTAATTGTAGGTGCTGTGTATACAAACCGTCAATTATAATTGG
CATATTTCTGGATGCAAATGTTTGTTGTGATTGTGATTATTTTGTACCTTAAACAGACAATTTTATTAACCGCTTCTACAAATAAGCTATCCGTGACACATGATGAAGCAGAGGACTATG
CCTCTTTGATCATGGAATCTCTCGACAAGAAAAAGAAAGGCTACATTGAG
GTACCAATTAAGCCTCAACCTCCCCATTACCACATGGTCACCCTATTCCATATTTTATTAAACTAAATAG
AAAGATTCGTCGTCATATGTAGACATCTCAAATGGGGTCTCTATTCAAGGCAAGTCTATCAAAGGCACATTCTCCAATGAAACAAGTAGCAGCAACAGGAAGCAGCATACAGAATGTTCA
CAAGACTAATGGTGGTGACTTTTGTGATGAAGAAGAAGAACCAATGTCATGGACGGAAGTGTTGTTCAGAACGTACTGGAGACGTTGTTGGGTTGTTCTACTTTGGGTGCTTGCATGTTT
GGGGTTATTTGTGTGGAAATTTGTCCAGTATAGCCATAGATCAGGGTTTGAAGTCATGGGTTATTGCCTTCCCACTGCTAAAGGTGCAGCTGAGACGTTAAAACTCAACATGGCTCTCGT
TCTTCTTCCGGTTTGTAGAAACACAATCACGTGGCTCCGCAAACACCGTCCCATCAACTCTGTCATTCCATTCAATGACAACATTAACTTCCACAAG
GTACCCTCTCTAATTGTTCCTTC
ATTTCATTTAACTTGTTCATAACACATTTCTTGGAACCCGAACTGAGAAATTCTTGTATGAATTGGAATATCGTGTGTTTATGGTTCCAAATAATGGATAAAGCTTATATGTAGTATCTT
AAGTATTGTTCGCCCTGTTCTACAATTAGAATCAAAGCTTCACTTCACTAATATATAGGTAAAACTCAAATTTTAACATGAAAACAATATCAACAATACTTTTAATATCATAATTTAGTG
TTATTTTTTCTATAATAATCTACTTAGATATAAATTTTAGAACGTTTTTGAAAATTTCTTTATTATAAAATATATATATTTTTTATATTTTTAATAAAAAAACTTTTAACTTATATCTAA
TAAAATTCCAAGTATATTTAGTATTGCCTTTCAATCAAAATTAAAATAGTCCATATAATGAATTTCATTAAATGCCAATGTGTTCGATTCTTATGGGAGAATAATATGTGGAGTAACTAT
AGTACTGCATCTAAGTTGTCCATCAAACGTGTTTACAATATAGTTAGCAGATGACTGAATTTGTTAAACAAAAAAATGATAGACTCCATTTTTCTTTCTACTATTGGTACATAGCAAAGC
ACATTGTAAGAATGATGTGGAAAAACAAAGATGATGCCATTAGTAGTTTAATTTAGCGGACGTACTATGCAGTTGATTGCAGGAGGAATAGTGGTGGGAGTGATATTGCACGGTGGGACG
CACCTGGCGTGTGATTTTCCGAGAATTAGTGAGTCAGACAGATCGATATTCCGGCAAACGATTGCGGCGGGGTTCGGTTACCACCGGCCGACGTACGTGGAATTATTGGCCACGACGGAG
GTGACGAGTGGGATAGGCATGGTGGTGTTAATGGGCGTCGCATTTCCGCTGGCGACGAAGTGGCCAAGGCGTCGGTCACCGGTGCTGCCGGTGTCCCTCCGACGTGTCACCGGATACAAC
ACCTTTTGGTATTCCCACCATTTGTTTGTCCTCGTCTATGCCTTGCTCATCATTCACTCCATGTTCTTGTTCCTTACCGACAAGTTGATGGAGAAAACG
GTAACCCTTTTTTCATCACTT
TTTCCATCCTTGTTTCTTCTGTGTTTTTTACTTTCTCGTGATTTTTGGCGTCATTTCACTGCCTTGCTGCGTTAATATAACAATAGAGTAAAGTGAATGTGAATGTTTATTCTTCTTTTT
TTTACTAATAACGGTTAATAAAAAAAACACCCACTCACTCATTCAAGTCTAGTTTTCTATTGGGAAGACATGGACAGCCACGTATGAGACTCGTTTTGTCGAATTCTATTACTGTGTGTC
TCTTGTAACATGTATTATATATTATGTCAGTTTTTTTCTCTCAAAAAATATTAAAAAATGTGGCATTATGAACCTACCAGAAACAGTTGTTTAGCACTTACCAGAAAAATGTGGCATTGA
GAATGTTCAAGACTGAATTATTGACTCTTCTGCATTATTTGAACTCCTTGCCACTACTTTATTCCGAGTTGTTCATTGTTGTGATTAAGACGGTAGCAAAAGTTACTAGAAAGCTCTTTA
ATTTAAAAAATTATAGAACAAATTTTGGTGTAGAATTTTAATTTCTATTTAATTTTCCATGTGCAGACATGGATGTACATTGCTTTTCCAGTTTTGTTATACGCCGGAGAAAGGATCTTT
CGAGCCATTAGATCTGGATCTTACGAAGTTGATATTTTGAAG
GTATTTGATCAGCTTTTCTATATATTCAACTGTTTGTAAAATATGTGGGTTTAAAGTTTCTGTTGATAAATTTTCTAG
TAAAAAAATTTGAAATTTTAATTTTAATTCTAATTTTAAATTGATTTATTCAAACAAGACATTTAAAGAATAATAAAATTAAAATCAAATAACTTAAATTTTTTGAAGTTTTAAAATTTC
TCTTCCAAACTCAATAATAGATAATATTTAATAATTTTAAAAAATATTTTTTAAATATTCAATAACTAAGAAATAAGAGAGATAAAAGATATACAAATAAAATAAGAAATAAAAATACGA
ATAATTTTAAATTCTTATTTTTTTTGAATAACATATACAAGATTTTAAATTCAAATCCTGATATTATTAGTGTAATTCCAATGAAAAAAATTCTTAATTATTTTTAAAAAAAATTGAAAT
TATATTATTTTAAGAAATTTTATAAATACTTAAATTTTAAAAAAAAATTATTCCATTTAAATTTTTTATTGAAACACAGTATTATTTCTTTTCTCAAGGATATTTATTATCTTATCCTTT
TCTTTTTCTTATATAGGCAAGTCTATATCCAGGAAAAGTTTTGTACCTCAAAATTCAAAAACCAGAAGGTTTTAAGTTCCAAAGTGGCATGTATATATTCCTTCAGTGCCCCCAAATTTC
GCCCTTTGAATG
GTACTTCTGCTTCCTTCATGCGACCATTTTTATTTACAATTAATTCAATTCATTATTCCAATTTTTGTGTTGTCCAGTTGGTCAATCAATATCGATGTTCTATTTGAG
TTTCTTTTGTCTAAATTTTCAGGCATCCGTTTTCCTTGACTTCAGGACCACGAGATGATTACCTCAGTGTGCACATTAGAACACTCGGAGACTGGAGCTACCAAATATATGCTCTATTCC
AAGAG
GTGAAAATAGAAAATTTTAAGTGCAAAATTGTGCTTTTTGGAATTCTTTGGCCTGAAAATTTGTCCGCAATCTGCAGGCGGTGTTATCACGATCACAAGGGTGTCCAAAACTGTA
CATAGATGGCCCTTATGGCTCTGCTGCTCAAGACCATGTAAAGTATGACATTCTGGTACTAATTGGTCTTGGCATAGGAGCCACACCTTTCATTAGCATCCTTAAAGATGTAGTTAAAAG
TGTCCAGACAACGCAAATTGATGAT
GTAAGATTTTCTATTGTGTTATTTATTTGAGTATTTTCTTTCTATGATAAATGTCTTCACTAAAATTCAATTGCTCTGCTTCTGTCTCATTAAAC
AAATGCCACATTTTGGGCATTCGAAATAGAGTGGTCTCAGAAAATGCAGCTTAACAAAGGGTCCATTAAAAGCATATCTTTATTGGGTTACAAGAGAGCCAAACTCTTTTGACTGGTTTA
GAGATGTCATGAAGGAAATCTCAAATTCAACCAAAAAGCAG
GTATGCCTAACTACAATTTGTTTGGAAAAAGTACTGTGTCAGCACAACTATATCTTTCTTTTATTATAAATGTGCAATT
AAAATCTTCAAGGATTTTTCTTAACTATCTAATTTTCTGATAATCTTTAAGTCGGTTGTGGAGATGCACAATTTCCTGACCAGTGTACATCCAGAAGGAGATATTCGTTCAGCTTTGCTA
AGTGTGATTCAGGCCTTGCATTTTGCCAAGAATGGCACTGACATAGTTTCCAGGACTCCA
GTAAGTGCATCTTCTCTTTAGTTTTAGTCAATATATGTAGCCAAAATATATGAATTACAA
GCAACCTTTAAATTTAGAGTAGTGGCGTTAAAGAAAATCATACAAGATAGTTTAGGCTTGATGCCTTCTGGTTGAAGTTAGATTACGTTATTGTCATTTTGCTATATATCAAGTTTGGCA
TAACAAAACAACATTCTTCAATCTGTCATTTCAAACCATGTTATTAACTGCTCCAACTTAAAGTCGCTTGGAAGAATCTTAACAAATACATGTCAGCCAAAATATTTTTTTTTAAATAAA
TGAATCATTCGTGTCTGGTCAAGACTGCACATATGTTTTGTTGTTGTTTGATTAAAAAAATATTTCTCCATCCAAAATTTTCAGATACACACGCATTTTGCTCGACCAAATTGGTTCAAC
ATATTTTCTAGATTGGCTCGCAAGCATGGAGGAGCTAAGATTG
GTGAGAAAAAAATTCCCTCGTGATTCAAGATTTTTATTTCTTTTAATGAAACTCGTTACTTAATTGTATAAATTCCC
AACTTTGTATCTTATTTAATCATTGAAATAGGCATGCTTAATTTAAAGGCTAAAGTTTTACCCAACCCCCCTATCTCTATATATTTATATTATATAAGAAAATAAGAGGTTAAATTGTTT
TCCTAACTAGGGATATGAGTTTTCTCTTACAGGGGTTTTCTATTGCGGCCCATCTAAATTAGCAAGAGAGTTGAAGAAGTTATGCACCAAATTTTCCACCAAAACCACAACTAGATTTGT
TTTCCACAAGGAAAACTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGGGCTTCTAAAGTCCCAAATTCCTCTTAATGATCGTTCCCTCATTGCTCTCTTCAAATCATCACCTTCTTCTTCGTCCTTGTCTTCTTCTTCGACCGTCAAAGAAGTCCTTCAT
TCCTCGTCCCTGGTTCAAACCAGGTACGAGGTTTCTAACGATGTAGCAGACTTGAGTTCGGAACAAAAACAAAAATGTTCTCACATAATAGAAAATGGAGCAATTCAAGGTGTGAGGTTC
ATCAATGGCATTGTTGGTCAGAGTGGAATGGAGTGGAAGGATGTGGAGAACCGGTTCGACCAACTTGGTCGAACCGGTTCTGGAGCCGAACCGGTTGTGGCATGGTCCGAATTTGGCTCC
TGCGTTG
GGATGCAGTCATCACCCGAGTTTGCCAATGAATTGCTAAGAGCGTTGAGAGGAGGCAAGCATTGGAAATCCAATATCACCAAAACTGATTTGTACAATCTTTGGTTTCGGATG
AAGGACAATTCTTTTAACTCGAGATTGCGAATCTTCTTTGACAT
GTGTAACAGAAACAAGGACGGAAGAGTCACCGAAACAGATATAAAACAGACAATTTTATTAACCGCTTCTACAAAT
AAGCTATCCGTGACACATGATGAAGCAGAGGACTATGCCTCTTTGATCATGGAATCTCTCGACAAGAAAAAGAAAGGCTACATTGAG
ACATCTCAAATGGGGTCTCTATTCAAGGCAAGT
CTATCAAAGGCACATTCTCCAATGAAACAAGTAGCAGCAACAGGAAGCAGCATACAGAATGTTCACAAGACTAATGGTGGTGACTTTTGTGATGAAGAAGAAGAACCAATGTCATGGACG
GAAGTGTTGTTCAGAACGTACTGGAGACGTTGTTGGGTTGTTCTACTTTGGGTGCTTGCATGTTTGGGGTTATTTGTGTGGAAATTTGTCCAGTATAGCCATAGATCAGGGTTTGAAGTC
ATGGGTTATTGCCTTCCCACTGCTAAAGGTGCAGCTGAGACGTTAAAACTCAACATGGCTCTCGTTCTTCTTCCGGTTTGTAGAAACACAATCACGTGGCTCCGCAAACACCGTCCCATC
AACTCTGTCATTCCATTCAATGACAACATTAACTTCCACAAG
TTGATTGCAGGAGGAATAGTGGTGGGAGTGATATTGCACGGTGGGACGCACCTGGCGTGTGATTTTCCGAGAATTAGT
GAGTCAGACAGATCGATATTCCGGCAAACGATTGCGGCGGGGTTCGGTTACCACCGGCCGACGTACGTGGAATTATTGGCCACGACGGAGGTGACGAGTGGGATAGGCATGGTGGTGTTA
ATGGGCGTCGCATTTCCGCTGGCGACGAAGTGGCCAAGGCGTCGGTCACCGGTGCTGCCGGTGTCCCTCCGACGTGTCACCGGATACAACACCTTTTGGTATTCCCACCATTTGTTTGTC
CTCGTCTATGCCTTGCTCATCATTCACTCCATGTTCTTGTTCCTTACCGACAAGTTGATGGAGAAAACG
ACATGGATGTACATTGCTTTTCCAGTTTTGTTATACGCCGGAGAAAGGATC
TTTCGAGCCATTAGATCTGGATCTTACGAAGTTGATATTTTGAAG
GCAAGTCTATATCCAGGAAAAGTTTTGTACCTCAAAATTCAAAAACCAGAAGGTTTTAAGTTCCAAAGTGGCATG
TATATATTCCTTCAGTGCCCCCAAATTTCGCCCTTTGAATG
GCATCCGTTTTCCTTGACTTCAGGACCACGAGATGATTACCTCAGTGTGCACATTAGAACACTCGGAGACTGGAGCTAC
CAAATATATGCTCTATTCCAAGAG
GCGGTGTTATCACGATCACAAGGGTGTCCAAAACTGTACATAGATGGCCCTTATGGCTCTGCTGCTCAAGACCATGTAAAGTATGACATTCTGGTA
CTAATTGGTCTTGGCATAGGAGCCACACCTTTCATTAGCATCCTTAAAGATGTAGTTAAAAGTGTCCAGACAACGCAAATTGATGAT
AGTGGTCTCAGAAAATGCAGCTTAACAAAGGGT
CCATTAAAAGCATATCTTTATTGGGTTACAAGAGAGCCAAACTCTTTTGACTGGTTTAGAGATGTCATGAAGGAAATCTCAAATTCAACCAAAAAGCAG
TCGGTTGTGGAGATGCACAAT
TTCCTGACCAGTGTACATCCAGAAGGAGATATTCGTTCAGCTTTGCTAAGTGTGATTCAGGCCTTGCATTTTGCCAAGAATGGCACTGACATAGTTTCCAGGACTCCA
ATACACACGCAT
TTTGCTCGACCAAATTGGTTCAACATATTTTCTAGATTGGCTCGCAAGCATGGAGGAGCTAAGATTG
GGGTTTTCTATTGCGGCCCATCTAAATTAGCAAGAGAGTTGAAGAAGTTATGC
ACCAAATTTTCCACCAAAACCACAACTAGATTTGTTTTCCACAAGGAAAACTATTAA

Retrieve as FASTA