Entry information : CcajRboh03(Cajca_10167)
Entry ID 16344
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-04 (Christophe Dunand)
Peroxidase information: CcajRboh03(Cajca_10167)
Name CcajRboh03(Cajca_10167)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Cajanus cajan    [TaxId: 3821 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcajRboh03
start..stop
S start..stop
GmRboh02 1732 0 1..884 1..885
GmRboh15 1707 0 1..884 1..871
PvRboh02 1698 0 1..884 1..881
PauRboh04 1693 0 1..884 1..881
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59..563 505 N° 2 1157..1316 160 N° 3 2543..2591 49 N° 4 3005..3118 114
N° 5 3310..3738 429 N° 6 3931..4317 387 N° 7 4423..4518 96 N° 8 4620..4735 116
N° 9 4839..4941 103 N° 10 5054..5127 74 N° 11 5360..5871 512 N° 12 5967..6076 110
join(59..563,1157..1316,2543..2591,3005..3118,3310..3738,3931..4317,4423..4518,4 620..4735,4839..4941,5054..5127,5360..5871,5967..6076)


exon

Literature and cross-references CcajRboh03(Cajca_10167)
Protein ref. GenBank:   XP_020212169.1   KYP71208.1 [Incorrect prediction]
Cluster/Prediction ref. Genebank:   109796787
Protein sequence: CcajRboh03(Cajca_10167)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   884
PWM (Da):   %s   100511.79  
PI (pH):   %s   9.47
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIEESHEQEYAWSETESTGSRSTRVGFSGPMSGPLVVSNKKSTKKSARFKDDQDFVEITLDVRDDGVSLQNIKGGDPETALLATRLEKRPSSLSLRLRQVSQELKRMTSSKKFDRVDRTKSGAARALRGLKFITKNVGTEGWSQVEKRFDELAVESKLPKTRFSLCIGMHESKEFAGELFDALSRRRGITSGSITKDELREFWEQITDQSFDSRLQTFFDMVDKNADGRIAEEEVKIIALSASANKLSKIQERAEEYAALIMEELDPDNLGYIEIYNLEMLLLQAPAQSTHITTDSRIMSQMLSQKLVPTKEHNPIKRGLRALAYFVEDNWKRIWIIALWLAICAALFTWKFIEYKHRAVFHVMGYCVTSAKGAAETLKFNMALILLPVCRNTITWLRSKTKLGMAVPFDDNINFHKVIAFGIAIGVGIHAIAHLTCDFPRLLHATDEEYEPMKPFFGEERPNNYWWFVKGTEGWTGITIVVLMAIAYTLAQPWFRRGRLNLPKPLKKLTGFNAFWYSHHLFVIVYGLFIVHGYYLYLSKKWYKKTTWMYLAIPMILYACERLLRAFRSGYKSVKILKVAVYPGNVLALHMSKPQGFKYSSGQYIFVNCSDVSPFQWHPFSITSAPGDDYVSVHIRTLGDWTSQLKAVFAACQPASGDQSGLLRADMLQGNNIPRMPNILIDGPYGAPAQDYKNYEVILLVGLGIGATPLISILKDVLNNMKQQKDIEEGMVESGVKNKRKPFATNRAYFYWVTREQGSFEWFKGVMDDVAEYDKDGIIELHNYCTSVYEEGDARSALITMLQSLHHAKSGVDIVSGTRVKTHFARPNWRSVFKHTALKHPGKRGVFYCGAHALVGELKRLSLDFSRKTNTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTGAAGAGAGCCATGAGCAGGAGTACGCGTGGTCGGAGACGGAGAGCACGGGGAGCAGGAGCACGCGAGTGGGCTTCAGTGGGCCCATGAGCGGCCCACTGGTGGTGTCCAAC
AAGAAGAGCACCAAGAAGAGCGCCAGGTTCAAGGACGACCAGGACTTCGTCGAGATCACGCTGGACGTGCGCGATGACGGCGTCTCCCTCCAGAACATCAAGGGCGGCGACCCCGAGACC
GCGCTCCTCGCCACCCGCCTCGAGAAGCGCCCCTCCTCGCTCTCCCTGCGCCTCCGCCAGGTCTCGCAGGAGCTCAAGCGCATGACGTCATCCAAGAAGTTCGACAGGGTCGACAGGACC
AAATCTGGCGCTGCTCGCGCCCTCCGAGGCCTCAAGTTCATCACCAAAAACGTCGGAACTGAAGGCTGGTCACAGGTGGAGAAGCGTTTCGATGAGTTGGCCGTTGAATCCAAATTGCCC
AAAACGCGCTTCAGTCTGTGCATTG
GTATGTATAATGTATAATACTTTATTCTGCTTTTTCAAACCATGCACGTGTCAAACTTACTCATTTTATGCTTTTGTTATACGTATTATTATCAA
ATGAAACATATATATACGTACTTAACCTATTTGAGGATGGGACAGTATTTTTTTTTAATATTTATTTTCTTATACTTAATTTACTTTGAATCTGTCTTTATTTATTTATTTACTTTTTTG
CATCAAGTGTGTCATTAAAATATTAATTATTTTAATCTATCTTATTATTTACCTATTAAGCTTGGTGTAGGCAGACTAGAATACATTATAATAATAATAATAAAAAGTGTGAGAGTTATT
GTCCTTTAGTGAGATTAAATAATTAAGAATGTGTTTAAAATATGTTAAATAAAAGAATGCACTACTACTCCTACAGTTTCTTCACTGGGATTGGTCAATATAGTATCATATTTTATTCTT
TTAAATAAAAGTAATTTTAAAAACTGGATATTTTTATAAATTTAATATTATTAACCAATTTAATAATTTTTGAAGCTCTGTAAATTAATTACAAATGTCTAACAAATATCGGTGAATTTT
GGACGGAATGATGTATAGGCATGCACGAGTCGAAGGAGTTTGCTGGCGAATTATTTGATGCATTATCTCGTCGTCGGGGCATAACATCAGGTTCCATAACCAAGGATGAGTTGCGCGAAT
TCTGGGAACAAATTACGGATCAGAGTTTTGATTCAAGGCTTCAGACCTTCTTTGATAT
GTAAGCTTTTATACTTCAATTTCATTTCCTTTTTTTTTTTTTTTTTATAAAAAAAATTCCTT
AATTAAAAATGACCCTTATATATATAGAATATCATCAGAGATAGTGGGACATTGCTTAGCGATTATTTTTCGCTGTCAAACAGAGAAAAAAACAACGCCGCATTTCGTGCATTTGCATGT
GAAACATGCATGCGTCATAATACAATTATTGACTTTCTAATATTATAAATCTATGATCATTAAATACAACGAAAGGCACCGGAAGCAGCGTGAGACTTTTTTTTAAGGTACTTAAGTGAC
GCGTTTTTTTTGTAACATCTTCAAATGAAGAGGTTTTGAGTGTAGTTCTTGTTAACAGTATTTTATTTATGTCATAAGAGTTTCACTATCAGTCATTTTAAGGTTAATGTTATGCCTGAT
GCCTTAATTATCGACTTCTTTTGTTTCAAAATATAAAAGTAGTATATGTAAAGAAGATTAATATAGATACGAATTTTCAATTATAATTAAATACTTATTTGAATTATATGTTTAATTGAA
AAATGATCTAAAATAAAACTCTTTCAGGGCTAGGTGTTTCTACGTTTTCTTTAGTATGAGATTATAATTTTCACTCTGGGGTAAACTTAATTAATTAGTCTAAACACATTGTATTTATGT
TGAATTTTGGAACCCTATATTATAACTAGATTCTACGTCAATGTCAATTCGCTAAATGAGCTACACCTCCAGGTTAAAATAATGAGTTGGTCTATGTATTTATTTAAAACACTTCTACAA
ATTGTTTTGCTTATTCTTTAAGGATGTGAGTTATTTTATTCATTAATCGGTCAATCCTTAACATATTTTAAGATTAGGTGTGGAATAATCGGGGGTGTAGCTAGAGAGTACGAAGAAATC
ATCATGAATATTAAACAACAAATTGAATACATAAAGAAAAAAAAATGAATGAATCAACGGTTGGCCCCTTTAAGGGAGGAAAAAAGAAGGAAAGAATCAAAGCTTTGGCCATTTAAGAAA
AAGAACGAATCAACGGATGGTTGGGTTGACCTTTGAAAAATGCATGTGAAATAAGCTAGCAGCTAATTGAGAAACATTACATGTACGTATATCTAAGTCAAAAAAGAAAAACAATAATGA
GTTAAATGTCAACATTATTGAATTTTGATTGGATCTTCACCCATTTGCTATGACTTGTCCCTAAATAATTTTAATTCATGTCAGGGTGGACAAGAATGCCGACGGAAGAATCGCCGAAGA
AGAAGTTAAAGAG
GTGAGGGTTTACTGTGATAAGAAGATAAAAAAATATTCTCTCTTTATTTTTTATTCTCGTACTTGAGAGAGGGAAAAATGAAAAATTTGTATTGAAAAATCCTGCAC
AAAAAAAAATATTGTATTTGTTTTTATCTTTATTTTTCTTATCTCTCTTATACATTAGAGAGTAAAAAATAAGCTATATATTCCTTAATCTAGAAGTCGTATATATATTATTGTTTCAAT
ACTTTATTTAATGATTTTAATTACAGAAGTAATTTTATAAGATATTAAATTTATTAATTGAGGTGGTAACATGTAACATGTCATTCGATATTAGTGTAAAACTTTTTTTACCACAACAAT
ACATTATTTATCATTTTACAAGAAGCTTGTGGAGATGTGAACATTATTGTGTGATTCATTTTACAGATTATCGCCTTAAGTGCTTCCGCTAATAAGCTATCAAAAATACAAGAAAGAGCG
GAGGAATATGCAGCCCTTATCATGGAGGAGTTGGATCCAGATAACCTTGGATACATTGAG
GTTTATATTCTATCCAATTGAGCCTGTTTTCATTGTACAACAATCATAACAATAGTCTAA
TAAAAAAAGTCCAATGAAATGAGCCCAAGGCTTGCTTTAAAACTGGCCTTTAAGGGGGGGAATATTATTTAATTTAATTTAATTTAATTTTCCCTTCAAACATGTCACTTATATTCTATT
TTTGCATGCAGATATACAACTTGGAAATGCTACTTTTGCAAGCCCCAGCACAATCAACCCACATAACCACGGATAGCCGTATTATGAGTCAAATGCTGAGCCAAAAACTAGTCCCAACCA
AAGAGCACAACCCCATCAAGCGTGGCTTAAGGGCACTGGCATACTTCGTGGAGGACAATTGGAAACGGATTTGGATCATTGCCCTCTGGCTTGCAATTTGTGCTGCCCTTTTCACTTGGA
AGTTCATCGAATACAAGCACCGTGCCGTGTTCCATGTCATGGGCTATTGTGTCACATCAGCCAAAGGTGCTGCTGAGACCCTCAAGTTCAACATGGCCTTAATCCTTTTACCTGTATGCA
GAAACACCATCACTTGGCTCAGAAGTAAGACCAAGTTAGGCATGGCCGTTCCCTTTGATGACAACATTAACTTTCACAAG
GTACACTTACTTATAATAAAACTTACATATAGTTCTGTAA
ATATCGTTGCTGATGTTCTTCATAAGTATTGTTCCTTGTTTAAAATCAGAGTTTTATCAAAGTATATAATTAGTATTTATATTTAATAAATTTTTTTAATTACTCCTAGTTAGCTAATAA
TTAATGACATTGATGGTGTCACTTTGGTTTAGGTGATAGCTTTTGGCATTGCAATTGGGGTTGGGATACATGCTATTGCCCATTTAACGTGTGACTTCCCAAGATTGTTGCACGCAACGG
ACGAGGAATATGAGCCCATGAAGCCATTTTTTGGAGAAGAGAGGCCCAATAATTATTGGTGGTTCGTGAAAGGGACAGAGGGATGGACCGGGATAACCATAGTGGTGCTTATGGCTATAG
CCTACACTTTGGCTCAGCCATGGTTCAGACGAGGCAGGCTCAACCTCCCTAAACCTCTCAAAAAGCTAACCGGGTTCAACGCGTTTTGGTACTCTCACCACCTTTTTGTCATCGTCTATG
GACTTTTCATCGTTCACGGATACTACTTGTACCTTTCCAAGAAATGGTACAAGAAAACG
GTATGCATGCTCTCACTATATTATATCCTCGTTTTCCTTTTATTTTTCTTCACATGAAATT
TTGTTCTTATGTTCTGAATTTGGTCACACATTTTATTGCCACAGACTTGGATGTATCTTGCAATTCCCATGATACTATACGCATGCGAACGATTACTTCGTGCTTTTAGGTCTGGCTACA
AAAGTGTCAAGATTTTGAAG
GTACACTAATTGAAAAGATTTAATTAATTTCAATTTTGCATTTTGCTACTAATGAAGATATGAGAATACTAATTTTTTTTTATGCTTTTTTTTAAATTCA
GGTTGCAGTGTACCCAGGAAATGTCTTGGCCTTGCACATGTCTAAACCACAAGGGTTTAAGTACTCTAGTGGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATGGTA
AGTGAACATTCCTTTTCTTATTGTTTTTATTACACACATTAATATTAAAATGAGGAGAGTGAAGTTAACAATGCTCACAATTTTGTTGTGGTATCTGTAGGCATCCTTTCTCTATTACTT
CAGCCCCGGGAGATGACTATGTAAGCGTTCACATACGGACTTTGGGTGATTGGACATCACAACTGAAGGCTGTTTTCGCCAGG
GTACAAACACTTTTCTTCATTATGCTAATGATGTTAT
AATATGTAGTGTTAGTTGAACCTTCTCCTCAAATATGTTCATGGCCTAAAAAATTTGCCATGTTTATTGATACAGGCATGTCAACCAGCAAGTGGTGACCAGAGTGGTCTTCTAAGGGCT
GATATGTTACAAGGCAACAACATTCCAAG
GTAAGTTATGAACTAGAGACAACGATTTTTGGACAAAATTTAGGTGTCATTGGTGATGTTTTTCAATCAGAGATTAAAGTTGAAATTTGAT
CTCAATAATGTGTGTAATTCTGATTGAAAAACGATACCAACAATACTTATGATACTGAATCAAAGTTTCATCTATGGTTTTAGTACTTAAAACACCAAATTGATTCTTTACTAATTCTAG
TGAAATTTAAATTAATTGTAGGATGCCAAACATTTTGATTGATGGTCCTTATGGAGCCCCAGCACAAGACTACAAAAACTATGAAGTAATCCTTCTGGTGGGTCTAGGAATTGGTGCCAC
CCCTTTGATTAGTATACTGAAAGATGTGCTAAACAACATGAAGCAACAGAAGGACATAGAAGAAGGGATGGTAGAGAGTGGAGTTAAGAACAAGAGGAAACCCTTTGCCACCAACCGGGC
CTATTTCTATTGGGTGACTCGTGAGCAAGGTTCCTTTGAATGGTTCAAGGGTGTGATGGATGATGTTGCGGAGTATGACAAGGATGGAATAATCGAGCTTCATAATTATTGCACAAGTGT
GTATGAGGAAGGAGATGCTCGATCGGCTTTGATCACAATGCTTCAATCGCTGCACCATGCAAAAAGTGGTGTGGATATAGTTTCGGGGACAAGGGTGAAGACACATTTTGCTAGACCAAA
TTGGCGCAGTGTTTTTAAACATACTGCACTTAAACACCCTGGCAAAAGAGTTG
GTAAGAACTAGTACTGATTTTCTCTTAGTTAATTTAATTGTTGAATTCATGTCATCATGTCTTGCTT
AAGCTCACAATGCTTCAATCATTTCCAGGTGTTTTCTACTGTGGGGCGCACGCACTGGTTGGAGAACTTAAAAGGCTTTCTCTCGACTTTTCTAGAAAGACCAACACTAAGTTTGATTTC
CATAAAGAGAATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTGAAGAGAGCCATGAGCAGGAGTACGCGTGGTCGGAGACGGAGAGCACGGGGAGCAGGAGCACGCGAGTGGGCTTCAGTGGGCCCATGAGCGGCCCACTGGTGGTGTCCAAC
AAGAAGAGCACCAAGAAGAGCGCCAGGTTCAAGGACGACCAGGACTTCGTCGAGATCACGCTGGACGTGCGCGATGACGGCGTCTCCCTCCAGAACATCAAGGGCGGCGACCCCGAGACC
GCGCTCCTCGCCACCCGCCTCGAGAAGCGCCCCTCCTCGCTCTCCCTGCGCCTCCGCCAGGTCTCGCAGGAGCTCAAGCGCATGACGTCATCCAAGAAGTTCGACAGGGTCGACAGGACC
AAATCTGGCGCTGCTCGCGCCCTCCGAGGCCTCAAGTTCATCACCAAAAACGTCGGAACTGAAGGCTGGTCACAGGTGGAGAAGCGTTTCGATGAGTTGGCCGTTGAATCCAAATTGCCC
AAAACGCGCTTCAGTCTGTGCATTG
GCATGCACGAGTCGAAGGAGTTTGCTGGCGAATTATTTGATGCATTATCTCGTCGTCGGGGCATAACATCAGGTTCCATAACCAAGGATGAGTTG
CGCGAATTCTGGGAACAAATTACGGATCAGAGTTTTGATTCAAGGCTTCAGACCTTCTTTGATAT
GGTGGACAAGAATGCCGACGGAAGAATCGCCGAAGAAGAAGTTAAAGAGATTATC
GCCTTAAGTGCTTCCGCTAATAAGCTATCAAAAATACAAGAAAGAGCGGAGGAATATGCAGCCCTTATCATGGAGGAGTTGGATCCAGATAACCTTGGATACATTGAG
ATATACAACTTG
GAAATGCTACTTTTGCAAGCCCCAGCACAATCAACCCACATAACCACGGATAGCCGTATTATGAGTCAAATGCTGAGCCAAAAACTAGTCCCAACCAAAGAGCACAACCCCATCAAGCGT
GGCTTAAGGGCACTGGCATACTTCGTGGAGGACAATTGGAAACGGATTTGGATCATTGCCCTCTGGCTTGCAATTTGTGCTGCCCTTTTCACTTGGAAGTTCATCGAATACAAGCACCGT
GCCGTGTTCCATGTCATGGGCTATTGTGTCACATCAGCCAAAGGTGCTGCTGAGACCCTCAAGTTCAACATGGCCTTAATCCTTTTACCTGTATGCAGAAACACCATCACTTGGCTCAGA
AGTAAGACCAAGTTAGGCATGGCCGTTCCCTTTGATGACAACATTAACTTTCACAAG
GTGATAGCTTTTGGCATTGCAATTGGGGTTGGGATACATGCTATTGCCCATTTAACGTGTGAC
TTCCCAAGATTGTTGCACGCAACGGACGAGGAATATGAGCCCATGAAGCCATTTTTTGGAGAAGAGAGGCCCAATAATTATTGGTGGTTCGTGAAAGGGACAGAGGGATGGACCGGGATA
ACCATAGTGGTGCTTATGGCTATAGCCTACACTTTGGCTCAGCCATGGTTCAGACGAGGCAGGCTCAACCTCCCTAAACCTCTCAAAAAGCTAACCGGGTTCAACGCGTTTTGGTACTCT
CACCACCTTTTTGTCATCGTCTATGGACTTTTCATCGTTCACGGATACTACTTGTACCTTTCCAAGAAATGGTACAAGAAAACG
ACTTGGATGTATCTTGCAATTCCCATGATACTATAC
GCATGCGAACGATTACTTCGTGCTTTTAGGTCTGGCTACAAAAGTGTCAAGATTTTGAAG
GTTGCAGTGTACCCAGGAAATGTCTTGGCCTTGCACATGTCTAAACCACAAGGGTTTAAG
TACTCTAGTGGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATG
GCATCCTTTCTCTATTACTTCAGCCCCGGGAGATGACTATGTAAGCGTTCACATACGGACTTTG
GGTGATTGGACATCACAACTGAAGGCTGTTTTCGCCAGG
GCATGTCAACCAGCAAGTGGTGACCAGAGTGGTCTTCTAAGGGCTGATATGTTACAAGGCAACAACATTCCAAGGATGCCA
AACATTTTGATTGATGGTCCTTATGGAGCCCCAGCACAAGACTACAAAAACTATGAAGTAATCCTTCTGGTGGGTCTAGGAATTGGTGCCACCCCTTTGATTAGTATACTGAAAGATGTG
CTAAACAACATGAAGCAACAGAAGGACATAGAAGAAGGGATGGTAGAGAGTGGAGTTAAGAACAAGAGGAAACCCTTTGCCACCAACCGGGCCTATTTCTATTGGGTGACTCGTGAGCAA
GGTTCCTTTGAATGGTTCAAGGGTGTGATGGATGATGTTGCGGAGTATGACAAGGATGGAATAATCGAGCTTCATAATTATTGCACAAGTGTGTATGAGGAAGGAGATGCTCGATCGGCT
TTGATCACAATGCTTCAATCGCTGCACCATGCAAAAAGTGGTGTGGATATAGTTTCGGGGACAAGGGTGAAGACACATTTTGCTAGACCAAATTGGCGCAGTGTTTTTAAACATACTGCA
CTTAAACACCCTGGCAAAAGAGTTG
GTGTTTTCTACTGTGGGGCGCACGCACTGGTTGGAGAACTTAAAAGGCTTTCTCTCGACTTTTCTAGAAAGACCAACACTAAGTTTGATTTCCAT
AAAGAGAATTTTTAA

Retrieve as FASTA