Entry information : CcajRboh06(Cajca_16255)
Entry ID 16347
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-04 (Christophe Dunand)
Peroxidase information: CcajRboh06(Cajca_16255)
Name CcajRboh06(Cajca_16255)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Cajanus cajan    [TaxId: 3821 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcajRboh06
start..stop
S start..stop
GmRboh18 1694 0 1..938 1..935
GmRboh09 1682 0 1..938 1..928
PauRboh07 1641 0 1..938 1..930
PvRboh05 1640 0 1..938 1..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 292..620 329 N° 2 716..1005 290 N° 3 1437..1596 160 N° 4 3034..3082 49
N° 5 4340..4453 114 N° 6 6297..6719 423 N° 7 7449..7832 384 N° 8 7920..8015 96
N° 9 8622..8737 116 N° 10 8831..9004 174 N° 11 9251..9410 160 N° 12 9489..9692 204
N° 13 9800..9928 129 N° 14 10056..10134 79 N° 15 11583..11692 110  
join(292..620,716..1005,1437..1596,3034..3082,4340..4453,6297..6719,7449..7832,7 920..8015,8622..8737,8831..9004,9251..9410,9489..9692,9800..9928,10056..10134,11 583..11692)


exon

Literature and cross-references CcajRboh06(Cajca_16255)
Protein ref. GenPept:   XP_020221163.1
Cluster/Prediction ref. Genebank:   109803903
Protein sequence: CcajRboh06(Cajca_16255)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   938
PWM (Da):   %s   106652.78  
PI (pH):   %s   9.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTASFGRCSAGELEVPESCGTSSPAAGGHAYGAMLPVFLNDLRSNHHKELVEITLELENDAVVLCNVAPAPSLAPNASPSSSGEGGGGAVVARSLSITSRIRRKFPWLRIRRKFPWLRSVSSASSAESAAAAVAVEDPVATARNARKMRAKLERTRSSAQRALKGLRFISKSGEASEELWRKVEERFTLLAKDGLLAREDFGQCGMEDSKEFAVCIFDALARRKERKVSSINREELHEFWLQISDQSFDARLQIFFDMADSNEDGRITREEVQLIMLSASANKLAKLKEQAEGYAALIMEELDPENLGYIELWQLEMLLLEKDRYMNYSRQLSSASVNWSQNMTDLRPKNEIQRFYRALQCLALEYWRRGWVLILWLVITTCLFAWKFYQYKNKSTFQVMSYCIPVAKGAAETLKLNMALILLPVCRNTLTWLRSTRARKFVPFDDNINFHKMIAFAILVGVVVHAGNHLACDFPLLVNSSPEKFSIISSDFNDKKPTYKSLYISVEGMTGISMVILMIISFTLATHHFRRNAVKLPSPFNRLTGFNSFWYSHHLFGLVYVLLLIHGSFLHLTHRWYHKTTWMYISVPLLLYVAERTLRTRRSTHYTVKIMKVSRLPGNVFSLIMSKPNGFKYKSGQYIFLQCPKISPFEWHPFSITSAPGDEYLSVHIRIVGDWTQELKLLLTKEDERLPSLNCRATFGELMELDQTRQPRLLVDGPYGAPAQDYQNFDVMLLIGLGIGATPFISIIRDLLNNTRTTDELVQESNTETSQTTRSDESSNSFTSSNLTPGGNKILRRTTNAYFYWVTREPGSFEWFKGVMDEVAEMDHKGQIELHNYLTSVYEEGDARSTLITMIQALNHAKTGVDILSGTRVRTHFARPNWREVFTKIASKHPFSTIGVFYCGMPMLAKELKKLSLELSHKTTTRFEFHKEYF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACGGCGTCGTTCGGGAGGTGCAGCGCCGGAGAGCTCGAAGTGCCGGAAAGCTGCGGCACTTCGTCGCCGGCGGCCGGAGGACACGCCTACGGCGCCATGCTGCCGGTGTTCCTG
AACGACCTGCGGAGCAACCACCACAAGGAGCTCGTGGAGATCACGCTGGAGCTGGAAAACGACGCCGTGGTGCTCTGCAACGTGGCGCCGGCGCCGTCTTTGGCTCCGAACGCGTCGCCG
TCGTCGAGCGGTGAGGGAGGCGGCGGAGCGGTGGTGGCGAGGAGCCTCTCGATCACGTCGAGGATTCGGAGGAAGTTCCCGTGGCTGCG
GTCGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCCTCTCGATCACGTCGAGGATTCGGAGGAAGTTCCCGTGGCTGCGGTCGGTGTCGTCGGCGTCGTCGGCGGAGA
GTGCCGCTGCCGCCGTGGCCGTGGAAGATCCGGTGGCGACGGCGCGAAACGCGCGGAAAATGAGAGCGAAGCTGGAGCGCACGAGGTCGAGCGCGCAGCGAGCGCTGAAAGGCTTGAGGT
TCATCAGCAAGTCCGGCGAAGCCAGCGAGGAGTTGTGGCGAAAGGTGGAAGAGAGGTTCACCTTGTTGGCCAAGGATGGCTTACTCGCTCGTGAAGACTTTGGTCAATGCATAG
GTAATA
AGGAAATATATAATTCAAACAAAATAAAATAACATTACAATAACTCATTTAACTTGCATAACTAGTGTTCAACCCAGTTAATTATAGAGTTTGTTTATACAAAATTTATAAGTGATTTTG
AGATTATTTTTAATAAAAAAATTTCAATTCTACTTACAAGTTTTTATTCGAAAATACTAGTGGTTAGATGAAGAGGGATCGAGCATAATTAGAAACATGAGAATCTAGGTTTTTATTTGG
TATAGATGCAGATACAAATTTAAATATATTTTTGAAATTATTAATTAAAATTAAATAATAATTTTCAATAAAAAAGTTCTTAGAAAACAGTTTTAACTTGTACACAGATATACTGTGGAG
TAACATGATTATGTGCATATATTTTGCTAAAATAATTGTGAATTTGGTGAATTGAATGATGAAAGGGATGGAGGATTCGAAGGAATTTGCGGTGTGTATATTCGACGCATTGGCACGAAG
GAAGGAAAGGAAAGTGAGTAGCATAAACAGAGAAGAGTTGCATGAGTTCTGGTTGCAAATTTCGGACCAGAGTTTTGATGCTCGCCTTCAGATTTTCTTTGACAT
GTGAGTTTTTCATCA
CCTTCTACCACCGCTGTGTGTTTTCGTTACAATCATTAAGAAACACTGTCTTTTTTCCCATCACCGCCCGAGAAAATTCGTGGCTTATTAAATGTTTGGATAATGTATTTTTATACGTCA
TGTTTTTTTAGTTTCTTTAGAAAGAAAAAAAAAAAAAGTTTTGACTGTGCTCGGTGACTGTTAGCGTTATAAAATCACTAGTTAGAGGTTTTGTTTTTTTGGTACATCACTTGTTACAGT
TATAAAGCAATAAAACATACGGATTAAATTGGAAATGAATAGTATGAACAAGGATTTATAATACTATTAGTTTAATTAATATTATATCTCAAAATAATTTTATATCAATCTTATAGTATT
TATTACGTCAACAAATGAAAGGAGTGAATATTAAAAATATATAAAATAAATTAAATGAAAATAATTTTAATATAGAAAATTAATATAATCTGCACCGTAAAAATAAGAACAGAAATATAT
TTTTAGCGTAATTTTTTCATGACAAAATTGGATATAGGTTTTTGTCTAAATTATAAGATATTTGCTCCAATTTTTAATTTGTACAAGAGTTTACGTATATAACTTGTGCAATATTTTTTT
TAAAAAAAATTTCCCTTATTTTTCTTTTGCTATATTAGTTAAGAGGAAAACAAAAAGTCCACGGGATGATCGCATGAGTTTTGTCATTTTTCTTTTAAGATTGCGTTGCTTAAACACACA
GAACACATAGAATCTTATGAAAAATAATAAAATGAAGTTTAAGAAAGCCATTTAGCTTAAAATGAAGTTTAAGAAAGCCAATTTAGCTTGAAAAGGATTGTCCTATATATAGTTGCCAAA
AAGGAGATCGCCGTAATTCGTAAAGAAATCAATTAAATTCAAGTAAATCAGTTTATTAATGTAATTTCAAGTACCATTATATCTATAAGTTTATTTAAACACAATTTGATAGCTCAAACT
CAAATAGTAGAGTTAGGGGACATGTTGTAAAAAATAAAAGCAGGGTTCAATTGTTATGATCCTAAATATCCCACCTCAATATATCCAACTCCAATCGTTTGACATACAAACAACTCAGAA
TCTTATCTATATGTACTACTTTATATCAACCTATCTCTCATTTCAATCAATCTTTACTTTTGAATTTGATAAAAAAAGAAAAAGTAAACTATTTAAAGTCAATTTGATATTGACTTATAA
TTTAAGAATGAGATATTAATTTTCATATAAAACTTATATGATAATTTTCACTTAAGACAGTGACAAACAGCCCCTTGAATTAGGATGAATTATTCGTAAATTTTATTGCAACATCAATAC
GATTATTCTTTCACCTATAAACAGCTGCTTGCCGGGAGAACAAGCACTGAAATTTTTGATAATGTTTTTTAAATGTTAAATTAAAAATTGTATTTATTTCAGGGCAGACAGTAACGAAGA
TGGAAGAATTACTAGGGAGGAAGTACAAGAG
GTAAGATTTAAGATACCGAAAAATATACATATAAATATACCTAACTCTTTACTGAAGTTTCACCGTACAGTACCATTTGTAAAACTATA
ATATAATGTAATATTCTATAAATACAATTCTTAAATGAATGCTATTGAAAAACTGAATGAAAGATTAAAAAAAAAAAAAAAAGGAAACAGGACATGAAAATAATAGTTTTTGCAATTTTC
TTACCACCACCATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTGATAAAAAAATAAATAAATAAATCATCTTATATTTGTGAGTTGTGACCT
TAATTAAGAAGGTAAAGTTTTGAACTAGTACGCTTTAAGCAAAAGATTTAAGAGATTAACAAACAGTACGGATAATGTTAACTAAGGAACGACAAGTTAATCTTCAAGCGGATTTAAACA
CTATTTGATGTGATGGCTCTATAGCTAAATTTTACCATATTTAGAAATTGAGATAAATATGTTTTTAATTTTTTAAATTAAAAGTAATTTTTTTAATTTTTAAATTTAAATTAATCTTTT
TATTTTATATTTTTGTTTTTTAATTTTTATACTTAAATTTTATTAAAAAAATATGTTAAATATTATGATATAAAATCTATTTATCAAATATTTATAAATGAAAACATCACATTAAATTTA
ATTAATAATATATGATTATCTAAATTTATTATTTTAAAATATGTTATTGTTGTTTGAAAGACTATTTTTTTTTATATAAAAATTATATGATTAAAACTAATAATTTTAATTTTAAAAATT
AAAAATAAATTTACTCTTTTAAGAGTTAAAAAGATATTTAACCATCATAGATTTTATTACATCTAGTAGCTTGATGTATGTGTTAACAAAACCCAACAGGTGATCATATTAAAATGACTT
CATAAATTAATCATATAACTATCCACCGCTTTATTTTTTATTTATTATTATATATAATTGGTAAACGAAGGTTCCAAACAAATATTAATTTAATGGAAACCGTAGAAGTTTACATAATTA
CATTGTAGCTTACATTCATTCCGACAAATTAAATTGAATTAAAAATACATTATTATATTTATACTCATGAATCGATTGTAGAACAGAAATAAAGCGAGAGAGATATTGAATAGTAAGAGC
GTTGGCAAATTTATTTTATTACTTTTCTTGTCGCTGACGTGAACATCACGTTCTGATCATACTCTCTGTTTTCAATTTTATTCAACAGCTCATAATGCTCAGTGCTTCCGCGAACAAGCT
AGCTAAGCTAAAGGAACAAGCTGAAGGATACGCCGCGCTAATAATGGAAGAATTAGATCCAGAAAACCTGGGGTATATCGAG
GTAAGAGTGTGACACAGAGAGAAGGGAAACGAGAATAA
TTTGAAACTTCAAACTATTAATTACATAAGAAAAAAAATATTCCATTCGTATCATCCAATTTTTTTATTTTATTATTTGTTTTTGCAAACACTTAAGTTGAGTGACATCACTTATTTAAT
TTTTTTTAGTAGTATCAATTATATCGTTACATAGTCTCTGTCTCTCTTTTATATATATACAGTTAATCATTTATATACTATTAGTGTAGGATTTTTTTACATTAATAACTAATTAAATAT
TTTAATATCTTTTTATTGTATAATGATACCAATCATATCATTATACATTTCTTCAATCTTTTTATATCTTTCAAGATCTTTACACGTTTTGTGAACACTGGAGTGATGTTAATTTATTTA
TATCTCTTCTTGTTGTGAGACACTATCAATCATATCATCACATATTTTTTCTTCTTTTTATATCTTTCAAGATGTATACATGTTTTGCAAACACTCGATTGATGCCACTTATATAATTTC
TTTATCTCTCTCCTTGTAATGTAACATTATCAAATAATCATCACATGTTTCTTCTTTTCTTTTATATATTTTAAGGTGATTACACATTTTCCAAAAATCTTATCTCTTCTTATATATGTA
ACATTATTAATCATATTATCGCATTTTTTTATGTGTTTTTTAAGGTGCATGTTTTGCGAAAACTTGACACTATTTATTTTAATTTTTTTTATCTCTCTTCTTCTTGTTGCGTAACATTAT
TAATCATATTATTGCATATTTCTTCTTTCTTTTATATATTTCAAGGTGTTTACACATTTTGCGAATACAGAAATGATGCACTTGTTTTTTTTTTGTTTTTTTGTTTTTATATATTTTATT
TTATCTTTCTTATTATTATGTAACATATTATCAATCATATTATAACACATTTCTTCTTTCTTTTTATATCTTTCAAAGTGTTTGCATGTTTTAGTGAATTCGTAAGTGACACCATTTATT
TTAATTGATTTATCTCTTTTCATGTAGTGTAACATTATTGATCACATCATCACACATTTTTTCTTTCGTTTTATATCTTTCAGGTTGTCTGCATGTTTTGCATATACCCAAGTGATACCA
TCTTATTTCAATTTCTTTTTTTATCAATCTTTTTATTGTGTAACATTATTAATAATATTATCACAAATTTATTCTTTCTTTTTAAACCTTTCAAGGCATATGCTCATTTTGCTAAGTAAG
GTGTCTTATTTTAATTCTTTATCTCTTTTTCTTGTAGTGTAACATTATCAATCATATAATTACAATTTTCTTTCTTTCTTTTTATATTTTTCAAGGTGCTTAAACGCTTTCCAAACATTC
AAATGATACTATTTATTTTAATTTCTTTATCTCCTTTCTTATTGAGAAACATTATCAATCAATTTATCAAAAGAAAAAATTCTCAATCACATCATCACATACTGCTTTCTTTTTATATCA
TTCAAGTATTTTGTATTTTTTGTGAACACCCGAATGGTGCCACTTATTTTAATTTCTTTATCTATCTTCTTGTTGTGTTACATTATTAATCATATCATCATATTCTTTTTGTCTTTCTTT
TTATATCTTTCAAGGTGAATGTCTGAGCATTTTATAAATAGTCAATTGTTGAAACTTATTATAATATCTTTATCTTTCTTCATGCTGTGTGACATTATCAAACGTATCATCAAATTTTTT
TTATACTTTTCAATGTGTCTACATTGAAAGGTACTATCACAGAATTTATTTCCTTTTGAATAGTATATTTTTGTTTACAATTTTTGTTACACTTTCTTGATCGCTTAAATTTGTCTTTTA
TTCAGTTGTGGCAACTAGAAATGTTGTTACTAGAAAAGGATAGGTACATGAACTACAGCAGACAACTCAGCAGTGCAAGTGTAAATTGGAGTCAAAATATGACGGACTTGAGGCCCAAAA
ATGAAATCCAAAGATTTTACAGGGCACTCCAATGTCTTGCATTGGAGTATTGGAGAAGGGGTTGGGTTTTGATATTATGGCTGGTTATCACTACTTGCCTTTTTGCCTGGAAATTCTACC
AATATAAAAATAAATCAACTTTTCAAGTTATGAGCTATTGCATACCAGTAGCTAAAGGTGCTGCAGAGACACTGAAGCTCAACATGGCTCTCATCCTCTTACCAGTTTGTCGAAATACGT
TGACATGGCTTCGTTCTACCAGAGCTAGAAAGTTTGTCCCTTTTGATGACAATATTAATTTCCACAAG
GTATGTAAAATAGAGATGATGTCAACTTAGGATATTTTAAATGCAAAAAAAG
TTCTGTATAATTTTCAAATAGTAAATCTCTTAAAACAGAGGTTTTAATTAATACAACTTAGGGTGCTTTAAATTATTCATTATCATTCTAGCTAATAACTACTACACCCATTTCAAAATA
ACTATAATTTAATATTTTTACACATTAATAACAACAACAAATATATCACTTATTTAATACAATTTTATTTCTTAATAAAAGTATTACTTTTAGTTGTAGTGGTTAAAGAAATTGTGAGCG
GCTAAATTAGGAAAGAGAAAATTAATATTTCTTTGAAAACTGAGAACATGAGTCTTTTTGAAAAAAATTTCAAATGTTAAAATTGTAGTTATTTAGGACAGAGAGAGTACTTTGCTTAAA
ATTAAAAAGAAAAATCCAAATATAGTAATTGTAAAAAAAATATTTTTAAGAAGTAAATAGAAATTATTTTAAAAAAAATTGATTTTTTTTTAAATAGCTTAGTCAAACATAAAAAATAAA
AATTAATTATTTAATTAGAAAATATTTTTAAATTAAAAAATTAACAAACATGCCCTAATTTATTTATTTTGCTAATTATGAAGGCTCTACTTATAGTATTGAGACATGATATTACTTGCT
CTCCAAAAATGGCAATATTTTAAATTAAGCTGGTATAAATTCCTCACAATTTGATTGTGTCCTTGTCCATTTTATAGATGATTGCATTTGCCATACTTGTTGGAGTTGTTGTTCATGCTG
GCAATCATCTGGCATGTGATTTCCCTCTTCTCGTAAACTCATCTCCAGAGAAGTTTTCGATTATATCTTCAGATTTTAATGACAAAAAACCCACATATAAATCACTTTACATTAGTGTGG
AAGGCATGACTGGAATCTCAATGGTTATTTTGATGATAATCTCTTTCACTTTAGCAACTCACCACTTCCGGAGAAATGCAGTGAAGCTTCCGTCACCCTTTAACAGATTGACAGGCTTTA
ATTCATTCTGGTACTCACACCATCTTTTTGGTTTGGTCTATGTTCTACTCCTCATCCATGGGTCATTTTTGCATTTAACCCACCGTTGGTACCATAAAACA
GTAAGAATTTCGACTGCTC
TACAACATGGGATAAGTGAGTGTTGTTTAAAGAACATACATCAACTTACCGTTTCCTTTTAATTTCAGACATGGATGTATATCTCTGTTCCACTGTTGCTTTACGTTGCAGAGCGTACTC
TACGCACTCGTAGATCAACACATTATACTGTGAAAATTATGAAG
GTAATGAAAACAAGTCCATGTTTATTTTTCAAGCTTAAATACATCCTCAAATATGGAGTAAAAAATTTTAAATTTG
GAAGACCGAAAACAAATTTACTTCATATTTAAGCATATTTCTATTTCTAGTAGTGGGTGAATACACCAAGAAAAAAAACCACTTATGAGTAGGGAGTAATTTATGACTAGCCTTTTCTTT
CTTTGATGAAAATTTGCATATGGTCTTTTCCTTGGTCATTATCTCTTTGATTTTTTTATGAACAAAATTGATTATTCTGACTTTTGAGTGTATTTGATTCCATGTTTGAATTGAAGGAAA
TGAGTCCCCTTTAGATAATCCACGTGTATTTTGGAATAAAAGAATTTATGGAGAAATATTTTAAGGAAAAATATGTCATGTCTTTTTGTATTTTGGCATGAAGAAAACTAGGATGAAGAA
AAAATAAAACCTATCTAGACTTAAGAATATGGATTTGGACATAATTTAATCTTAGAAAAACTAACTTTTAACATGAAGATTATCCATCACTTATGCAATATATTTTGATTATATCTCTAA
TTGATATGAGATTTCTAATACATGTCAATTTCCTAACTTTGATCTAGCAGGTTTCAAGGTTGCCCGGAAATGTCTTCAGCTTAATCATGTCCAAGCCTAATGGATTTAAGTACAAAAGTG
GACAATATATATTTTTACAATGTCCAAAAATTTCTCCCTTTGAATG
GTGAGTGTTGTTCTAATTCTCAGGTCTACTAAAAAGTTATAGACATGAGAAAATTCAAATTCAAATTAAATATT
TTCATGAAATATATTTTAGGCACCCATTTTCCATTACCTCGGCCCCAGGAGATGAGTACCTAAGTGTTCACATTCGCATAGTGGGAGACTGGACCCAAGAACTTAAGCTTCTTCTCACAA
AAGAAGATGAGAGATTACCTTCACTTAATTGTCGTGCAACATTTGGTGAACTAATGGAACTGGATCAAACAAG
GTAAGTAAGGTCAATTGTTTTTTCATAAATGCAATGGTAAAAAAATG
TTAGATTGCTTAAGTTTTTGTCCTTTGTATTTTAATAACAATAGTTTTGATCATTATATTTTTTAAAATGTGGTGGGTTTGATCCTACAGTTTGTAAAATACTAGACTAAGATTAGTTTT
GACCAAATATTAAGAGACTCAACATTTTACCCCAATTTCGTGAATGAAAATTATTAGACAAAATAGAATTTTGTTTCAGACAACCGAGACTTCTAGTTGATGGTCCTTATGGAGCTCCAG
CACAAGACTACCAAAATTTTGATGTAATGCTCCTCATAGGATTAGGAATTGGAGCAACTCCTTTCATTAGCATTATCAGAGATCTCCTCAATAACACAAGAACAACGGATGAACTAGTG
G
TACTAACAAAACTCTAGCTCACTTTTCAGAAAGTTGATTCCACTTTTATCTTCAATTTTCAATTTTCTTATATTCAGGTGCAGGAATCAAACACAGAAACAAGTCAAACAACTAGATCAG
ACGAAAGCTCTAATAGTTTTACATCTTCAAATTTAACACCAGGAGGAAATAAGATATTAAGAAGGACTACAAATGCTTATTTCTACTGGGTCACTAGGGAACCTGGATCTTTTGAATGGT
TCAAAGGAGTAATGGACGAAGTTGCTGAAATGGACCACAAA
GTAATATATGATGTTCATAAATAAGTTTCAATCCTACTTATAAATAGTTCTCTACTATACTAGCTGTCCCTGTTTTTTG
TTATAAATTGTTTTTTACTCTAAATCAGGGTCAAATTGAGCTTCACAACTATCTTACAAGTGTCTATGAAGAGGGGGATGCGAGATCAACCTTAATCACCATGATCCAAGCTTTGAACCA
TGCCAAAACTGGTGTTGATATCCTATCAGGCACTCGA
GTAAGATCTTCAATACTTGAAATTGTTAACATAATGAGCAAGTTTTTTTTTTTTTTTTTTTTTTGCTTAAGTTGATAATGATT
ACTCACCAAAATATGACACTTTTTTAAATTGTTTTCAACTATAGGTAAGGACACACTTTGCTAGGCCTAATTGGAGAGAGGTTTTCACCAAGATTGCCTCTAAACATCCATTTTCTACAA
TAG
GTAAATTTCTTGCTACAAGATGCAGAACACTTCCTCATAAAGGATATTTAATTTTCCTTTTCATCCGGTAATATTGGGACAACAAATGATTTTTATTCATTTGCCTATGATATGCTT
CACATAAGGGTCAAGCCATAAGTCTTCTCCATTGATATCATTGGGTTCACAACACTACAAATATGGTGGTTACAATGAAAACGATTGATAAAAATGAAAATACAATGCAGTAGTAATTGA
CTGAAATTATGAATGATATCATGATATAGAATTGTGTAATGGTCAAAACAATCAAACTTATAAGGAATTATGAATCTATTTGTTCAATTGATCATGATGAAGAAATTGATATCTAATTAA
ACAATTTTTCAATTATTTTATGAAGACTAAATTTTATTGGTATAATTTTTTTTAAGAAAATAACACATATATAAAGATAGAGAAAAATAAAGAAAGAAGTAGGGGTATACCAACATTATG
ATATACTAAAGTATATATTAATATTTTTATATGAACAAAACTGAGTTGATTAGATGCATCGTATTAATAATACAAATTTATAATGTTTAGACTATAAATTCATTTCATGAAATTAAATTT
ATGTTAACAAAGATATTTCCAACACTTAAATCAAAGTAATCCTTCCTTTCAATTTTTTTTAGGGATTCTAATTGTTTTTTTTTTCTAAAAGAAAATGTTGTTTTAAAATTCCAATAACAA
ATTAGACTTTTTTCTCTCAATTATATCCCTATTTAATAATATTTCTCTCCACTAACTGCTCATTTAGTTTTACTAGAGGGTAAGCTACACAACCAATGAGCACACAAGTATTAATGTTAC
TAATAGATATTAAATAAGGACTTTTTAGTCCAACATTTTTAGTCCATGTTCATTAACCTTAAGCCATTAAAGAAATGAGGGAAAAGTAGTTAAAATGTACTTGTAATAGAAATTAACCCT
CCTTTTGTATCCAAAAATAATCAATGTTATTTACGATTTACTACTTAAATAAGTTTGGTTGGTTAACTACTATAATGGAATAAACAGCCTTATAACCTTAATGACACAATTTTTTCCTTT
TACTTTTAATATTTTGGAATGTATGTTCATTTTTTTTTTTTGAAACATTTTAAATGGTTTCTAAACATGTCCTTAGTCATTGACTTTATAACCACTGTTGGAATACGATTAAATAGTTGG
ATAGTTAATTATCCCTAAAAGATTTAAAGTATCAACAATTGAGAAATTGTGATTTAGAACAAACAAATGTCAATTATGAACCAACCTTATTTGTAAACAAAGAATATTGATAGGTACGGA
TGAACAATTGGTTTGTTTAAGAGAAGGAAACAAGTAGTTTATTATATGTTCACTTATAAAGTGTGATCCATTTTTTTTTACTTCTCAATATTAGTAAATATTAACAAGAAAATGATGTAT
AAAAAATCCAGGTGTGTTCTATTGCGGGATGCCAATGTTGGCGAAGGAGCTAAAGAAGCTATCACTTGAGCTAAGTCACAAGACAACTACACGCTTTGAATTTCACAAGGAGTACTTTTG
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACGGCGTCGTTCGGGAGGTGCAGCGCCGGAGAGCTCGAAGTGCCGGAAAGCTGCGGCACTTCGTCGCCGGCGGCCGGAGGACACGCCTACGGCGCCATGCTGCCGGTGTTCCTG
AACGACCTGCGGAGCAACCACCACAAGGAGCTCGTGGAGATCACGCTGGAGCTGGAAAACGACGCCGTGGTGCTCTGCAACGTGGCGCCGGCGCCGTCTTTGGCTCCGAACGCGTCGCCG
TCGTCGAGCGGTGAGGGAGGCGGCGGAGCGGTGGTGGCGAGGAGCCTCTCGATCACGTCGAGGATTCGGAGGAAGTTCCCGTGGCTGCG
GATTCGGAGGAAGTTCCCGTGGCTGCGGTCG
GTGTCGTCGGCGTCGTCGGCGGAGAGTGCCGCTGCCGCCGTGGCCGTGGAAGATCCGGTGGCGACGGCGCGAAACGCGCGGAAAATGAGAGCGAAGCTGGAGCGCACGAGGTCGAGCGCG
CAGCGAGCGCTGAAAGGCTTGAGGTTCATCAGCAAGTCCGGCGAAGCCAGCGAGGAGTTGTGGCGAAAGGTGGAAGAGAGGTTCACCTTGTTGGCCAAGGATGGCTTACTCGCTCGTGAA
GACTTTGGTCAATGCATAG
GGATGGAGGATTCGAAGGAATTTGCGGTGTGTATATTCGACGCATTGGCACGAAGGAAGGAAAGGAAAGTGAGTAGCATAAACAGAGAAGAGTTGCATGAG
TTCTGGTTGCAAATTTCGGACCAGAGTTTTGATGCTCGCCTTCAGATTTTCTTTGACAT
GGCAGACAGTAACGAAGATGGAAGAATTACTAGGGAGGAAGTACAAGAGCTCATAATGCTC
AGTGCTTCCGCGAACAAGCTAGCTAAGCTAAAGGAACAAGCTGAAGGATACGCCGCGCTAATAATGGAAGAATTAGATCCAGAAAACCTGGGGTATATCGAG
TTGTGGCAACTAGAAATG
TTGTTACTAGAAAAGGATAGGTACATGAACTACAGCAGACAACTCAGCAGTGCAAGTGTAAATTGGAGTCAAAATATGACGGACTTGAGGCCCAAAAATGAAATCCAAAGATTTTACAGG
GCACTCCAATGTCTTGCATTGGAGTATTGGAGAAGGGGTTGGGTTTTGATATTATGGCTGGTTATCACTACTTGCCTTTTTGCCTGGAAATTCTACCAATATAAAAATAAATCAACTTTT
CAAGTTATGAGCTATTGCATACCAGTAGCTAAAGGTGCTGCAGAGACACTGAAGCTCAACATGGCTCTCATCCTCTTACCAGTTTGTCGAAATACGTTGACATGGCTTCGTTCTACCAGA
GCTAGAAAGTTTGTCCCTTTTGATGACAATATTAATTTCCACAAG
ATGATTGCATTTGCCATACTTGTTGGAGTTGTTGTTCATGCTGGCAATCATCTGGCATGTGATTTCCCTCTTCTC
GTAAACTCATCTCCAGAGAAGTTTTCGATTATATCTTCAGATTTTAATGACAAAAAACCCACATATAAATCACTTTACATTAGTGTGGAAGGCATGACTGGAATCTCAATGGTTATTTTG
ATGATAATCTCTTTCACTTTAGCAACTCACCACTTCCGGAGAAATGCAGTGAAGCTTCCGTCACCCTTTAACAGATTGACAGGCTTTAATTCATTCTGGTACTCACACCATCTTTTTGGT
TTGGTCTATGTTCTACTCCTCATCCATGGGTCATTTTTGCATTTAACCCACCGTTGGTACCATAAAACA
ACATGGATGTATATCTCTGTTCCACTGTTGCTTTACGTTGCAGAGCGTACT
CTACGCACTCGTAGATCAACACATTATACTGTGAAAATTATGAAG
GTTTCAAGGTTGCCCGGAAATGTCTTCAGCTTAATCATGTCCAAGCCTAATGGATTTAAGTACAAAAGTGGACAA
TATATATTTTTACAATGTCCAAAAATTTCTCCCTTTGAATG
GCACCCATTTTCCATTACCTCGGCCCCAGGAGATGAGTACCTAAGTGTTCACATTCGCATAGTGGGAGACTGGACCCAA
GAACTTAAGCTTCTTCTCACAAAAGAAGATGAGAGATTACCTTCACTTAATTGTCGTGCAACATTTGGTGAACTAATGGAACTGGATCAAACAAG
ACAACCGAGACTTCTAGTTGATGGT
CCTTATGGAGCTCCAGCACAAGACTACCAAAATTTTGATGTAATGCTCCTCATAGGATTAGGAATTGGAGCAACTCCTTTCATTAGCATTATCAGAGATCTCCTCAATAACACAAGAACA
ACGGATGAACTAGTG
GTGCAGGAATCAAACACAGAAACAAGTCAAACAACTAGATCAGACGAAAGCTCTAATAGTTTTACATCTTCAAATTTAACACCAGGAGGAAATAAGATATTAAGA
AGGACTACAAATGCTTATTTCTACTGGGTCACTAGGGAACCTGGATCTTTTGAATGGTTCAAAGGAGTAATGGACGAAGTTGCTGAAATGGACCACAAA
GGTCAAATTGAGCTTCACAAC
TATCTTACAAGTGTCTATGAAGAGGGGGATGCGAGATCAACCTTAATCACCATGATCCAAGCTTTGAACCATGCCAAAACTGGTGTTGATATCCTATCAGGCACTCGA
GTAAGGACACAC
TTTGCTAGGCCTAATTGGAGAGAGGTTTTCACCAAGATTGCCTCTAAACATCCATTTTCTACAATAG
GTGTGTTCTATTGCGGGATGCCAATGTTGGCGAAGGAGCTAAAGAAGCTATCA
CTTGAGCTAAGTCACAAGACAACTACACGCTTTGAATTTCACAAGGAGTACTTTTGA

Retrieve as FASTA