Entry information : MePrx01 (cassava4.1_011574m)
Entry ID 1660
Creation 2005-06-17 (Christophe Dunand)
Last sequence changes 2011-07-01 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx01 (cassava4.1_011574m)
Name (synonym) MePrx01 (cassava4.1_011574m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx01
start..stop
S start..stop
RcPrx17 615 0 1..331 1..331
MePrx23 611 0 1..331 1..327
PbPrx02 596 0 1..331 1..333
CclPrx35 593 0 1..330 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 422512..422736 225 N° 2 422863..423054 192 N° 3 423141..423306 166 N° 4 423434..423846 413
join(422512..422736,422863..423054,423141..423306,423434..423846)


exon

Literature and cross-references MePrx01 (cassava4.1_011574m)
Literature Lopez,C., Jorge,V., Piegu,B., Mba,C., Cortes,D., Restrepo,S., Soto ,M., Laudie,M., Berger,C., Cooke,R., Delseny,M., Tohme,J. and Verdier,V. A unigene catalogue of 5700 expressed genes in cassava
Plant Mol. Biol. 56 (4), 541-554 (2004).
DNA ref. Phytozome 12:   scaffold06512 (422512..423846)
EST ref. GenBank:   CK644523 [5' end]
Protein sequence: MePrx01 (cassava4.1_011574m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (309)
PWM (Da):   %s   36101.39 (33694.1)  
PI (pH):   %s   9.09 (9.22) Peptide Signal:   %s   cut: 23 range:23-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQSISILLLTTVLAFAPFISCAKTTGGYLYPQFYDHSCPNAQQIVESIVAKAVAKEARMAASLLRLHFHDCFVKGCDASILLDSSGRIISEKNSNPNRNSARGFEVIDEIKTALEKECPQTVSCADILALAARDSTVLAGGPSWEVPLGRKDSRGASLSGSNNNIPAPNNTFQTILTKFKLQGLNVVDLVALSGSHTIGNARCTSFRQRLYNQSGNGQPDYTLNQAYAATLRGRCPRSGGDQNLFFLDFVTPTKFDNSYFKNILASKGLLSSDQVLLTKNEASMELVKEYAENNKVFFEQFAKSMIKMGNISPLTGPRGEVRKNCRKINS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAATCTATAAGCATTCTCTTACTCACTACTGTCCTTGCCTTTGCTCCTTTTATCTCTTGCGCGAAGACCACAGGGGGTTACCTCTACCCACAGTTTTATGACCATTCCTGCCCT
AATGCTCAACAGATAGTCGAGTCTATTGTAGCCAAGGCAGTTGCAAAAGAAGCTCGTATGGCTGCCTCATTACTTCGGCTTCACTTTCATGACTGTTTTGTCAAG
GTCTGTGATCTGCAC
CCTGCAAATCCTATCATTATTTGTATTTGCAATGTCCACACTCCACAGGCACATAGCTTTTCTTCATGTGACAGTGTTTCTGATAACTTACAGAAAGCTTTTCAATTGCAGGGTTGTGAT
GCATCCATATTGTTAGACAGCAGTGGAAGAATAATCAGTGAGAAGAATTCTAATCCAAACCGAAACTCAGCTCGAGGATTCGAAGTTATTGATGAGATCAAAACTGCACTAGAGAAAGAG
TGTCCTCAAACAGTATCCTGTGCTGATATTTTGGCATTGGCAGCTAGAGATTCCACAGTTCTT
GTAGGTGTCACTTTCTTAGCCATATACTGAAATTAAACCACTGATAGTGATAAGTAC
TGAGCTGACCATCATTTTCATTTACACAGGCTGGAGGACCTAGCTGGGAAGTACCATTGGGAAGAAAGGACTCCAGAGGTGCAAGCTTGAGTGGTTCTAACAACAACATTCCTGCTCCAA
ACAACACATTCCAGACCATTCTTACAAAGTTCAAGCTTCAGGGCCTCAATGTTGTTGATCTTGTAGCACTATCAG
GTAACAAATAGATTCCTTTCGTCGTTGATTTAGCTTGAAAATCAT
CTCTGAAAACACTAATAATCTGCACTATGCGTGCCTCAAATTTTCTTTGCTAAATGCTTAAGTTTCCATGAATTTCTGGCAGGAAGCCACACAATCGGAAATGCACGATGCACCAGCTTC
AGGCAGAGGCTGTACAACCAGTCAGGCAATGGGCAACCTGACTACACTTTAAATCAAGCATATGCTGCAACATTGCGTGGCCGCTGTCCTAGATCTGGAGGTGACCAAAACCTGTTTTTC
TTGGACTTCGTAACTCCAACAAAATTTGATAATAGCTACTTCAAGAACATATTGGCTTCAAAGGGCCTGTTGAGTTCTGATCAAGTTCTTCTCACAAAGAATGAAGCATCCATGGAACTG
GTCAAGGAATATGCTGAGAACAATAAAGTCTTCTTTGAGCAGTTTGCCAAGTCGATGATTAAGATGGGAAACATCTCTCCATTGACAGGTCCAAGGGGAGAGGTCAGAAAGAATTGCAGG
AAAATTAATAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAATCTATAAGCATTCTCTTACTCACTACTGTCCTTGCCTTTGCTCCTTTTATCTCTTGCGCGAAGACCACAGGGGGTTACCTCTACCCACAGTTTTATGACCATTCCTGCCCT
AATGCTCAACAGATAGTCGAGTCTATTGTAGCCAAGGCAGTTGCAAAAGAAGCTCGTATGGCTGCCTCATTACTTCGGCTTCACTTTCATGACTGTTTTGTCAAG
GGTTGTGATGCATCC
ATATTGTTAGACAGCAGTGGAAGAATAATCAGTGAGAAGAATTCTAATCCAAACCGAAACTCAGCTCGAGGATTCGAAGTTATTGATGAGATCAAAACTGCACTAGAGAAAGAGTGTCCT
CAAACAGTATCCTGTGCTGATATTTTGGCATTGGCAGCTAGAGATTCCACAGTTCTT
GCTGGAGGACCTAGCTGGGAAGTACCATTGGGAAGAAAGGACTCCAGAGGTGCAAGCTTGAGT
GGTTCTAACAACAACATTCCTGCTCCAAACAACACATTCCAGACCATTCTTACAAAGTTCAAGCTTCAGGGCCTCAATGTTGTTGATCTTGTAGCACTATCAG
GAAGCCACACAATCGGA
AATGCACGATGCACCAGCTTCAGGCAGAGGCTGTACAACCAGTCAGGCAATGGGCAACCTGACTACACTTTAAATCAAGCATATGCTGCAACATTGCGTGGCCGCTGTCCTAGATCTGGA
GGTGACCAAAACCTGTTTTTCTTGGACTTCGTAACTCCAACAAAATTTGATAATAGCTACTTCAAGAACATATTGGCTTCAAAGGGCCTGTTGAGTTCTGATCAAGTTCTTCTCACAAAG
AATGAAGCATCCATGGAACTGGTCAAGGAATATGCTGAGAACAATAAAGTCTTCTTTGAGCAGTTTGCCAAGTCGATGATTAAGATGGGAAACATCTCTCCATTGACAGGTCCAAGGGGA
GAGGTCAGAAAGAATTGCAGGAAAATTAATAGTTAA

Retrieve as FASTA