Entry information : MePrx02 (cassava4.1_012142m)
Entry ID 1661
Creation 2005-06-17 (Christophe Dunand)
Last sequence changes 2011-07-01 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx02 (cassava4.1_012142m)
Name (synonym) MePrx02 (cassava4.1_012142m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx02
start..stop
S start..stop
RcPrx13 566 0 14..316 14..317
PtPrx44 553 0 1..316 1..317
MePrx121 540 0 21..316 22..318
GhPrx23 533 0 6..316 5..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2423633..2423839 207 N° 2 2423365..2423553 189 N° 3 2423092..2423254 163 N° 4 2422525..2422916 392
complement(join(2422525..2422916,2423092..2423254,2423365..2423553,2423633..2423 839))


exon

Literature and cross-references MePrx02 (cassava4.1_012142m)
Literature Lopez,C., Jorge,V., Piegu,B., Mba,C., Cortes,D., Restrepo,S., Soto ,M., Laudie,M., Berger,C., Cooke,R., Delseny,M., Tohme,J. and Verdier,V.
A unigene catalogue of 5700 expressed genes in cassava.Plant Mol. Biol. 56 (4), 541-554 (2004).
DNA ref. Phytozome 12:   scaffold07520 (2423839..2422525)
Protein sequence: MePrx02 (cassava4.1_012142m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (293)
PWM (Da):   %s   34016.15 (31538.8)  
PI (pH):   %s   8.92 (8.74) Peptide Signal:   %s   cut: 24 range:24-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPISILLFSSILLFSASSTGRALSFNYYEKTCPDVELIVTNAVKNAMVRDKTVPAALLRMHFHDCFIRGCDASVLLTSKGNNKAEKDGPPNVSLHAFYVIDNAKKEVEALCPGVVSCADILALAARDAIVLSGGPTWDVPKGRKDGRTSKASETIQLPAPTFNISQLQQSFSQRGLSMDDLVALSGGHTLGFSHCSSFQNRIRNFNATHDIDPTMNPSFAASLRSICPKSNAKNAGSPMDPSSTTFDNTYFKSILQGKTLFSSDQALLTSTGTKDLVSKFASSQDAFSKAFVKSMIKMSSITGGQEVRKDCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCATTTCCATATTACTCTTCAGTTCAATTCTCTTATTTTCAGCATCTTCAACAGGACGTGCACTGAGCTTCAATTACTATGAGAAAACATGTCCTGATGTCGAGTTGATTGTT
ACAAATGCAGTGAAAAATGCAATGGTGAGAGACAAAACAGTTCCTGCAGCTCTACTTCGTATGCATTTCCATGACTGTTTCATAAGG
GTGAGCGCTAGAACAGAACATCTTTTTTTCATC
CCTACTTTTTTCCTTGGAAACTGATTGTTTCCTTTCTGTTTTTAAGGGCTGTGATGCTTCTGTGCTGTTAACTTCAAAAGGCAACAACAAAGCAGAGAAGGATGGGCCTCCTAATGTTTC
TTTGCATGCCTTTTATGTCATCGACAATGCTAAGAAGGAAGTGGAAGCTTTGTGCCCTGGCGTGGTATCTTGCGCTGACATCTTAGCATTAGCTGCAAGGGATGCTATTGTACTT
GTAAG
ATAACAAAACAAAGCAAGCTATATTTGAAAAAACTGAAACATGAAATCAACTTTTGTCACTAAGATGTATAACTTTTCTGATTGTCCTTTCAATCAATTATGCAGTCTGGAGGACCAACG
TGGGATGTCCCAAAAGGAAGAAAGGATGGAAGAACATCGAAGGCAAGCGAGACAATACAACTGCCAGCTCCAACTTTTAACATCTCTCAGCTGCAACAAAGTTTCTCCCAAAGAGGTCTA
TCCATGGATGACCTAGTCGCTCTTTCAG
GTAATTAAAACTGTAGCCTGGTTATTCTCCTAGTGTTAGGTACTAACAAATGGTGCGGCACATTTTGAGTCACCCCATTTTATGAACCTCAA
AAAAGAAAAGGAAAAAAGAACCTTCGGTTACTTATATTTTCTATCTCATCAAAATAACAATGTTTGTGGCTACGAAAATGCAGGAGGGCATACTCTAGGATTTTCTCACTGTTCATCATT
CCAAAACAGAATCCGAAATTTTAATGCCACTCATGATATAGACCCCACCATGAATCCTTCATTTGCAGCAAGCTTAAGAAGTATTTGCCCAAAAAGCAATGCTAAGAACGCCGGTTCCCC
TATGGATCCTTCTTCAACAACCTTTGATAACACATATTTCAAGTCGATCCTACAAGGGAAAACCTTGTTCTCTTCAGACCAAGCTCTGCTCACAAGTACAGGAACTAAAGATTTGGTTTC
AAAGTTTGCTAGCTCACAAGACGCTTTCTCTAAGGCATTTGTGAAATCCATGATCAAAATGAGTAGCATCACAGGAGGTCAGGAGGTTAGAAAGGATTGTAGGGTGGTAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCATTTCCATATTACTCTTCAGTTCAATTCTCTTATTTTCAGCATCTTCAACAGGACGTGCACTGAGCTTCAATTACTATGAGAAAACATGTCCTGATGTCGAGTTGATTGTT
ACAAATGCAGTGAAAAATGCAATGGTGAGAGACAAAACAGTTCCTGCAGCTCTACTTCGTATGCATTTCCATGACTGTTTCATAAGG
GGCTGTGATGCTTCTGTGCTGTTAACTTCAAAA
GGCAACAACAAAGCAGAGAAGGATGGGCCTCCTAATGTTTCTTTGCATGCCTTTTATGTCATCGACAATGCTAAGAAGGAAGTGGAAGCTTTGTGCCCTGGCGTGGTATCTTGCGCTGAC
ATCTTAGCATTAGCTGCAAGGGATGCTATTGTACTT
TCTGGAGGACCAACGTGGGATGTCCCAAAAGGAAGAAAGGATGGAAGAACATCGAAGGCAAGCGAGACAATACAACTGCCAGCT
CCAACTTTTAACATCTCTCAGCTGCAACAAAGTTTCTCCCAAAGAGGTCTATCCATGGATGACCTAGTCGCTCTTTCAG
GAGGGCATACTCTAGGATTTTCTCACTGTTCATCATTCCAA
AACAGAATCCGAAATTTTAATGCCACTCATGATATAGACCCCACCATGAATCCTTCATTTGCAGCAAGCTTAAGAAGTATTTGCCCAAAAAGCAATGCTAAGAACGCCGGTTCCCCTATG
GATCCTTCTTCAACAACCTTTGATAACACATATTTCAAGTCGATCCTACAAGGGAAAACCTTGTTCTCTTCAGACCAAGCTCTGCTCACAAGTACAGGAACTAAAGATTTGGTTTCAAAG
TTTGCTAGCTCACAAGACGCTTTCTCTAAGGCATTTGTGAAATCCATGATCAAAATGAGTAGCATCACAGGAGGTCAGGAGGTTAGAAAGGATTGTAGGGTGGTAAATTAA

Retrieve as FASTA