Entry information : ZmPrx04 (Peroxidase 16)
Entry ID 167
Creation 2006-03-03 (Christophe Dunand)
Last sequence changes 2006-03-03 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx04 (Peroxidase 16)
Name (synonym) ZmPrx04 (Peroxidase 16)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Apical meristems
Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx04
start..stop
S start..stop
SbPrx96 625 0 13..332 17..337
SiPrx94 614 0 4..332 3..333
OsPrx58 607 0 1..332 1..337
BdiPrx134 589 0 12..332 24..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4211269..4211496 228 N° 2 4211584..4211781 198 N° 3 4212327..4212492 166 N° 4 4213162..4213568 407
join(4211269..4211496,4211584..4211781,4212327..4212492,4213162..4213568)


exon

Literature and cross-references ZmPrx04 (Peroxidase 16)
Literature Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R.
Maize peroxidase genes and their use for improving plant disease resistance and stalk strength
Protein ref. UniProtKB:   B4G0X5   B4FQA9 [Mismatch]
DNA ref. GenBank:   AC210003 (90201..92497)
mRNA ref. GenBank:   AX546792   BT043013
Cluster/Prediction ref. UniGene:   Zm.4541
Protein sequence: ZmPrx04 (Peroxidase 16)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (303)
PWM (Da):   %s   35300.13 (32660.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.45 (8.90) Peptide Signal:   %s   cut: 30 range:30-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARAGGGGPVRGAALVVVLLGIVVGAARAQLRQNYYGSSCPSAESTVRSVISQRLQQSFAVGPGTLRLFFHDCFVRGCDASVMLMAPNGDDESHSGADATLSPDAVDAINKAKAAVEALPGCAGKVSCADILAMAARDVVSLLGGPSYGVELGRLDGKTFNRAIVKHVLPGPGFNLDQLNALFAQNGLTQTDMIALSGAHTIGVTHCDKFVRRIYTFKQRLAWNPPMNLDFLRSLRRVCPLSYSPTAFAMLDVTTPRVFDNAYFNNLRYNKGLLASDQVLFTDRRSRPTVNLFAANATAFYEAFVAAMAKLGRIGLKTGADGEIRRVCTAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns) and 144 ESTs. GeneChip® Maize Genome Array ID: Zm.4541.1.S1_at
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAGCTGGAGGCGGCGGTCCGGTCCGCGGCGCGGCGCTGGTGGTCGTGCTGCTAGGCATCGTCGTGGGCGCGGCGAGGGCTCAGCTGCGGCAGAACTACTACGGCAGCTCGTGC
CCCAGCGCGGAGTCCACGGTGCGCTCCGTCATCTCGCAGCGCCTCCAGCAGAGCTTCGCCGTGGGGCCCGGCACGCTCCGCCTCTTCTTCCACGACTGCTTCGTCAGG
GTAAGCTAGCTG
CTGTCTGCTGAGGCACCAAGTCCGGCGTTTCCGTTTCAGGTACTTTGACCGAGCTTTAATCTGTGGAGTACGCAGGGATGCGACGCGTCGGTGATGCTGATGGCGCCGAACGGGGACGAC
GAGAGCCACAGCGGCGCGGACGCCACGCTGTCGCCGGACGCCGTGGACGCCATCAACAAGGCGAAGGCGGCCGTGGAGGCGCTCCCCGGGTGCGCCGGCAAGGTCTCGTGCGCGGACATC
CTCGCCATGGCCGCACGTGACGTCGTCTCCCTG
GTAAAAAAGAAAAAAACCTCCTTTCGGCGCCTCTCTATCTCTTTGGCCTCTTGTTGCTACCGGTTTCACCGCGTCACGTAGCGCAGC
GGGGCACTGGGCACGCCACGCCGGTGTCAGTGTCAGCGGCCAGGCACGCACGGGCCCACGCCTAGGCTGCGTCGTGCTGCTCGGTCCAGTTCACCGTCCCGTGTACTGTGCTTGACCCTC
CCGTAGAGACTAGAGAGAAAGAATGGAGATGGAGAGGCCCACCATTTGGGTTGGGGCGCCGGTACTGTTCCAAGCCTGCGTGCCAGTGAACTTTTTTCCCTCGGAGTCACAGGTTTTGGG
CCCCTTCGGCAGCAACGGCTTTGGCTTCGGACAGCGCAGAAGCTGGCTTTTTACGCGGCACGGGTCGTTGTCTCGTTGAGACAGTGACATGACATGAGGGATTGAGAGAGAGCACGGTGT
TGTTGTTGGCTGCCCTGCCCGTGACGCGGTGTCCCGGTCTTGCATTGCAAAGAAGAGATTTTTGCATCATTTTCATGCTTTGTTTTTGGTGTGTGCAGCTGGGCGGTCCGAGCTACGGCG
TGGAGCTGGGGCGGCTGGACGGCAAGACGTTCAACAGGGCCATCGTGAAGCACGTCCTCCCGGGCCCCGGCTTCAACCTGGACCAGCTCAACGCCCTCTTCGCGCAGAACGGCCTCACGC
AGACGGACATGATCGCGCTCTCAG
GTCAGCCTCACTGCCTGTACTCTACTCTACTCTGCGCTCCTCTCGGCCACAGCACTGTCAGCTCTAGTTCGTCGAGATGAATGAAACGCGACAGCC
TAGGCTGTGGCTGTCAAATTAACGACCGTGCCTCCTCGCTCTCGTTACTGTTCTCCTCTTTGGTCACTGTGACAAGGTAGGTAGGTAGCTCGATCGCAGTACAAAAAAACAAAGCATCTT
TTGTCTGTGGCTCACGTGACTTTATCTTTATCCTCCCCTCTGCCTTTGCGGCACCGAGACAAAGTGGTTCGCTGTTCTATGCTGCACCTGCACCCGCTCTGATGTTTTCAAAAAAAAAAA
AGAAGAGCCAGACAAAGTGGTTCATTTTCTGAGGACGTTGATTTGATTCATATAAACAACTAACAAAAGGTTCCTGGTGAACTTTTCGAGGGGTTTTTTTAGTTTGTTGCCTAGCTAGGC
TCTCATGTTTTGGTTCTGGTTTTTGTCTTTGATTCGGTGTTGGGAATGATAAAAGAACGACGTTTGTAGTACGTACATGGGAACAGGAGGGAGCACCTTTGTCTGAATGTTCTTGGTTCC
TGTCAGATCCTACTACGTAGTGTTTAGCAGCAGTAAAAATAAACCTCTCGATTCAGATTCCCAAATTAAACAAGCAACCGCAAATCTTTGCAGGCGCGCACACGATCGGGGTGACGCACT
GCGACAAGTTCGTGCGGCGGATCTACACGTTCAAGCAGCGGCTGGCGTGGAACCCGCCGATGAACCTGGACTTCCTGCGCTCGCTGCGGCGGGTGTGCCCCCTCAGCTACAGCCCCACGG
CGTTCGCCATGCTGGACGTCACCACGCCCAGGGTCTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTGCTCGCCTCCGACCAGGTGCTCTTCACCGACCGCCGCTCCC
GACCCACCGTCAACCTCTTCGCCGCCAACGCCACCGCCTTCTACGAGGCATTCGTCGCCGCCATGGCCAAGCTCGGCAGGATCGGCCTCAAGACCGGCGCCGACGGCGAGATACGCCGCG
TCTGCACCGCCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAGCTGGAGGCGGCGGTCCGGTCCGCGGCGCGGCGCTGGTGGTCGTGCTGCTAGGCATCGTCGTGGGCGCGGCGAGGGCTCAGCTGCGGCAGAACTACTACGGCAGCTCGTGC
CCCAGCGCGGAGTCCACGGTGCGCTCCGTCATCTCGCAGCGCCTCCAGCAGAGCTTCGCCGTGGGGCCCGGCACGCTCCGCCTCTTCTTCCACGACTGCTTCGTCAGG
GGATGCGACGCG
TCGGTGATGCTGATGGCGCCGAACGGGGACGACGAGAGCCACAGCGGCGCGGACGCCACGCTGTCGCCGGACGCCGTGGACGCCATCAACAAGGCGAAGGCGGCCGTGGAGGCGCTCCCC
GGGTGCGCCGGCAAGGTCTCGTGCGCGGACATCCTCGCCATGGCCGCACGTGACGTCGTCTCCCTG
CTGGGCGGTCCGAGCTACGGCGTGGAGCTGGGGCGGCTGGACGGCAAGACGTTC
AACAGGGCCATCGTGAAGCACGTCCTCCCGGGCCCCGGCTTCAACCTGGACCAGCTCAACGCCCTCTTCGCGCAGAACGGCCTCACGCAGACGGACATGATCGCGCTCTCAG
GCGCGCAC
ACGATCGGGGTGACGCACTGCGACAAGTTCGTGCGGCGGATCTACACGTTCAAGCAGCGGCTGGCGTGGAACCCGCCGATGAACCTGGACTTCCTGCGCTCGCTGCGGCGGGTGTGCCCC
CTCAGCTACAGCCCCACGGCGTTCGCCATGCTGGACGTCACCACGCCCAGGGTCTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTGCTCGCCTCCGACCAGGTGCTC
TTCACCGACCGCCGCTCCCGACCCACCGTCAACCTCTTCGCCGCCAACGCCACCGCCTTCTACGAGGCATTCGTCGCCGCCATGGCCAAGCTCGGCAGGATCGGCCTCAAGACCGGCGCC
GACGGCGAGATACGCCGCGTCTGCACCGCCGTCAACTAA

Retrieve as FASTA