Entry information : TsPrx04-2 (Thhalv10023814m / ThPrx04-2)
Entry ID 1674
Creation 2006-03-22 (Christophe Dunand)
Last sequence changes 2011-11-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx04-2 (Thhalv10023814m / ThPrx04-2)
Name (synonym) TsPrx04-2 (Thhalv10023814m / ThPrx04-2)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx04-2
start..stop
S start..stop
TsPrx04-1 639 0 1..316 1..316
BrPrx04-1Aa_other 605 0 1..316 1..317
BstrPrx77 600 0 1..316 1..316
AlyPrx04 599 0 1..316 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 251476..251673 198 N° 2 251211..251402 192 N° 3 250662..250830 169 N° 4 250177..250568 392
complement(join(250177..250568,250662..250830,251211..251402,251476..251673))


exon

Literature and cross-references TsPrx04-2 (Thhalv10023814m / ThPrx04-2)
DNA ref. Phytozome 11:   scaffold_8 (251673..250177)
Protein sequence: TsPrx04-2 (Thhalv10023814m / ThPrx04-2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (297)
PWM (Da):   %s   34187.15 (32093.0)  
PI (pH):   %s   8.25 (8.20) Peptide Signal:   %s   cut: 20 range:20-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIFKILVLLLSLSCFCQAQLSSTFYDQRCPNALSTIRSSIRTAISRERRMAASLIRLHFHDCFVNGCDASVMLVATPTMESERDALANFQSARGFEVIDQAKSAVERVCPGVVSCADIIAVAARDASEYVGGPRYAVKVGRRDSTAAFRAIADSGDLPNFTASLNELSDLFLRKGLNTRDLVALSGAHTLGQAQCVTFKQRLYDNSSDIDAGFSSTRKRRCPVEGGDTTLAPLDQVTPNSFDNNYYRNLMQKKGLLATDQVLFGTGASTDNIVSEYSRNTARFASDYAAAMIKMGDIQTLTGSAGQIRRICTAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCTTCAAGATTCTTGTGTTGTTGCTAAGCTTGTCTTGTTTCTGCCAAGCACAACTTTCTTCTACTTTCTACGACCAAAGATGTCCAAATGCTCTCTCAACGATCCGATCCTCA
ATCCGAACCGCCATCAGCCGCGAACGTAGAATGGCTGCTTCTCTCATCCGTCTCCATTTCCACGATTGCTTCGTAAAT
GTATGTCATTAACATTTTGATCTAACATGCGTGTGTGTTCAT
GGACCGCTCTAAAATTTGTATTTTTTTGTAGGGTTGTGATGCATCGGTCATGCTTGTGGCAACTCCTACCATGGAGAGTGAGAGAGATGCGTTAGCAAACTTTCAATCAGCGAGAGGATT
TGAAGTTATTGATCAAGCCAAATCTGCTGTTGAGAGAGTCTGTCCTGGTGTCGTTTCTTGTGCTGATATCATTGCCGTTGCCGCTAGAGACGCTTCTGAATAC
GTAAGTATTTATCAGTA
TCTGTAGCCATACGCATTGACATATGTCAGATATATTTACATGGTTAAATTTTATTTTTGATATTTGTAAGAAATATATATTTCATTTTTAACATAATCTTATGTAAGTACTGAATGAAT
TGTTCATTCCATTTTGTGTTTGAATTTTGCATATACAACTTTTATTTTTACAAGTCTCCATGTTAAAACTCTAAAGTATTTTATTTGAGAAAAAAATAAACACTATCTATTATAACATTA
ACATCTAAACGTAAAGATAAAAGAAATTGAGGTCATACGATATGCATTATACATCAGCTTTTTCAATTTGTTTTCTCGTAGTTCTAATAATTCTTTAATATGTAAATTTGGTGTCATCAA
TAGGTCGGAGGTCCACGATACGCAGTAAAGGTTGGTCGGAGAGATTCCACCGCCGCGTTTAGAGCTATTGCAGACAGCGGCGATCTCCCCAACTTCACGGCAAGCCTCAACGAACTCTCT
GATCTCTTCCTTCGAAAAGGTCTCAACACTAGAGACCTCGTCGCTCTCTCAG
GTCAGTCCCCAAAAACAAATTCTTACTCGCTAATTTGTTTTAATTACTATATTTTAAGAAATTTCTTG
TGACACAAGCAACTTCTATTTGCAGGAGCTCACACCTTAGGGCAAGCTCAATGCGTCACGTTCAAGCAAAGGCTTTACGACAACTCGAGCGACATTGATGCCGGATTCTCTAGCACACGT
AAGCGTCGCTGTCCGGTAGAAGGTGGAGATACGACCCTAGCACCTCTAGATCAAGTGACACCAAATTCGTTCGACAATAACTATTACAGAAACTTGATGCAGAAGAAAGGACTTTTGGCG
ACCGATCAGGTTTTGTTCGGAACCGGGGCTTCTACAGACAATATTGTGTCGGAATATAGCAGAAACACAGCTCGATTCGCGTCTGATTACGCAGCTGCAATGATCAAGATGGGAGATATT
CAGACACTCACTGGCTCAGCTGGTCAAATCCGGAGGATCTGCACTGCTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCTTCAAGATTCTTGTGTTGTTGCTAAGCTTGTCTTGTTTCTGCCAAGCACAACTTTCTTCTACTTTCTACGACCAAAGATGTCCAAATGCTCTCTCAACGATCCGATCCTCA
ATCCGAACCGCCATCAGCCGCGAACGTAGAATGGCTGCTTCTCTCATCCGTCTCCATTTCCACGATTGCTTCGTAAAT
GGTTGTGATGCATCGGTCATGCTTGTGGCAACTCCTACCATG
GAGAGTGAGAGAGATGCGTTAGCAAACTTTCAATCAGCGAGAGGATTTGAAGTTATTGATCAAGCCAAATCTGCTGTTGAGAGAGTCTGTCCTGGTGTCGTTTCTTGTGCTGATATCATT
GCCGTTGCCGCTAGAGACGCTTCTGAATAC
GTCGGAGGTCCACGATACGCAGTAAAGGTTGGTCGGAGAGATTCCACCGCCGCGTTTAGAGCTATTGCAGACAGCGGCGATCTCCCCAAC
TTCACGGCAAGCCTCAACGAACTCTCTGATCTCTTCCTTCGAAAAGGTCTCAACACTAGAGACCTCGTCGCTCTCTCAG
GAGCTCACACCTTAGGGCAAGCTCAATGCGTCACGTTCAAG
CAAAGGCTTTACGACAACTCGAGCGACATTGATGCCGGATTCTCTAGCACACGTAAGCGTCGCTGTCCGGTAGAAGGTGGAGATACGACCCTAGCACCTCTAGATCAAGTGACACCAAAT
TCGTTCGACAATAACTATTACAGAAACTTGATGCAGAAGAAAGGACTTTTGGCGACCGATCAGGTTTTGTTCGGAACCGGGGCTTCTACAGACAATATTGTGTCGGAATATAGCAGAAAC
ACAGCTCGATTCGCGTCTGATTACGCAGCTGCAATGATCAAGATGGGAGATATTCAGACACTCACTGGCTCAGCTGGTCAAATCCGGAGGATCTGCACTGCTGTTAATTAA

Retrieve as FASTA