Entry information : ZmPrx05
Entry ID 168
Creation 2006-06-02 (Christophe Dunand)
Last sequence changes 2006-06-02 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx05
Name ZmPrx05
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Mixed tissues
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx05
start..stop
S start..stop
SbPrx12 560 0 1..319 6..325
SiPrx164 560 0 4..319 8..323
OsPrx128 528 0 1..319 10..338
SofPrx07 509 0 3..285 8..294
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 83523327..83523533 207 N° 2 83523039..83523227 189 N° 3 83522204..83522767 564  
complement(join(83522204..83522767,83523039..83523227,83523327..83523533))


exon

Literature and cross-references ZmPrx05
Literature Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R.
Maize peroxidase genes and their use for improving plant disease resistance and stalk strength
DNA ref. GenBank:   AC205902.3 (158120..156788)
Cluster/Prediction ref. UniGene:   Zm.83590
Protein sequence: ZmPrx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (297)
PWM (Da):   %s   32836.46 (30635.2)  
PI (pH):   %s   6.98 (6.50) Peptide Signal:   %s   cut: 23 range:23-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVLHLQAAAVAVLLMATGLRAQLRVGFYDSSCPAAEIIVQQEVSRAVAANPGLAAGLLRLHFHDCFVGGCDASVLIDSTKGNTAEKDAGPNLSLRGFEVVDRIKARVEQACFGVVSCADILAFAARDSVALAGGNAYQVPAGRRDGSVSRASDTSNLPPPTANVAQLTQIFGTKGLTQKEMVILSGAHTIGSSHCSSFSGRLSGSATTAGGQDPTMDPAYVAQLARQCPQGGDPLVPMDYVSPNAFDEGFYKGVMANRGLLSSDQALLSDKNTAVQVVTYANDPATFQADFAAAMVKMGSVGVLTGTSGKVRANCRVA*

Retrieve as FASTA  
Remarks Complete sequence from Genomic (chromo 1, intron 1 and 2), 1 cDNA and 35 + 45 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTACTGCACTTGCAGGCGGCGGCGGTGGCGGTGCTGCTGATGGCGACGGGGCTGCGCGCGCAGCTGCGTGTGGGCTTCTACGACAGCTCGTGCCCAGCGGCGGAGATCATCGTG
CAGCAGGAGGTGAGCAGGGCGGTGGCGGCCAACCCGGGCCTCGCCGCCGGCCTGCTCCGCCTCCACTTCCACGACTGCTTCGTTGGG
GTCAGTCCCTCGGTCGCAAGCTCGCAGCTGCTG
CTCACACTTCAAAGGGCTGGTCGCAAACCAAGAACGACTGACCGCTTGTTTCTGCACTACCTGCAGGGCTGCGACGCGTCCGTGCTCATCGACTCCACCAAGGGCAACACAGCGGAGAAG
GACGCCGGGCCCAACCTCAGCCTGCGGGGCTTCGAGGTCGTCGATCGCATCAAGGCGCGCGTCGAGCAGGCCTGCTTCGGCGTCGTCTCCTGCGCGGACATACTCGCGTTCGCGGCCAGG
GACAGCGTCGCACTC
GTAAGTCACACTGCTTTAGTGTCAGTGGACGCCTGCCTTTTGATTTTAACCCGACATGATTAGTTTACATGGATTTGGAATCCAATGCTGGACTGGACTAGACTG
AAAAGCATATGTGTCTGTTCGACCTTTTTTGACGCACATGATGCCGCGTGCAGCTGCCTGAAAGAACTCGATGCATTGCCGGGCCCGGGCATGGGTCCAACTCCCAACTTTATTTACAGT
ATTTGCTTACTCTCCAATCCATCCATCCATCCATCCGTACGTATAGGCCGGCGGGAACGCGTACCAGGTGCCGGCGGGGCGGCGGGACGGGTCCGTGTCGCGCGCGTCGGACACCAGCAA
CCTGCCGCCGCCGACGGCCAACGTCGCGCAGCTCACGCAGATCTTCGGCACCAAGGGCCTGACGCAGAAGGAGATGGTCATCCTGTCGGGCGCGCACACCATCGGCTCCTCGCACTGCAG
CTCCTTCAGCGGCCGGCTGTCGGGGTCGGCCACGACGGCGGGCGGGCAGGACCCGACCATGGACCCCGCGTACGTGGCGCAGCTGGCGCGGCAGTGCCCGCAGGGCGGCGACCCGCTCGT
GCCCATGGACTACGTCTCCCCCAACGCCTTCGACGAGGGCTTCTACAAGGGCGTCATGGCCAACCGGGGCCTGCTGTCCTCGGACCAGGCGCTGCTCAGCGACAAGAACACCGCCGTGCA
GGTCGTCACCTACGCCAACGACCCGGCCACCTTCCAGGCCGACTTCGCCGCCGCCATGGTCAAGATGGGCTCCGTCGGCGTGCTCACCGGCACCAGCGGCAAGGTCAGGGCCAACTGCAG
AGTCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTACTGCACTTGCAGGCGGCGGCGGTGGCGGTGCTGCTGATGGCGACGGGGCTGCGCGCGCAGCTGCGTGTGGGCTTCTACGACAGCTCGTGCCCAGCGGCGGAGATCATCGTG
CAGCAGGAGGTGAGCAGGGCGGTGGCGGCCAACCCGGGCCTCGCCGCCGGCCTGCTCCGCCTCCACTTCCACGACTGCTTCGTTGGG
GGCTGCGACGCGTCCGTGCTCATCGACTCCACC
AAGGGCAACACAGCGGAGAAGGACGCCGGGCCCAACCTCAGCCTGCGGGGCTTCGAGGTCGTCGATCGCATCAAGGCGCGCGTCGAGCAGGCCTGCTTCGGCGTCGTCTCCTGCGCGGAC
ATACTCGCGTTCGCGGCCAGGGACAGCGTCGCACTC
GCCGGCGGGAACGCGTACCAGGTGCCGGCGGGGCGGCGGGACGGGTCCGTGTCGCGCGCGTCGGACACCAGCAACCTGCCGCCG
CCGACGGCCAACGTCGCGCAGCTCACGCAGATCTTCGGCACCAAGGGCCTGACGCAGAAGGAGATGGTCATCCTGTCGGGCGCGCACACCATCGGCTCCTCGCACTGCAGCTCCTTCAGC
GGCCGGCTGTCGGGGTCGGCCACGACGGCGGGCGGGCAGGACCCGACCATGGACCCCGCGTACGTGGCGCAGCTGGCGCGGCAGTGCCCGCAGGGCGGCGACCCGCTCGTGCCCATGGAC
TACGTCTCCCCCAACGCCTTCGACGAGGGCTTCTACAAGGGCGTCATGGCCAACCGGGGCCTGCTGTCCTCGGACCAGGCGCTGCTCAGCGACAAGAACACCGCCGTGCAGGTCGTCACC
TACGCCAACGACCCGGCCACCTTCCAGGCCGACTTCGCCGCCGCCATGGTCAAGATGGGCTCCGTCGGCGTGCTCACCGGCACCAGCGGCAAGGTCAGGGCCAACTGCAGAGTCGCCTGA

Retrieve as FASTA