Entry information : ZmPrx10 (Peroxidase17 / GRMZM5G843748)
Entry ID 174
Creation 2006-06-02 (Christophe Dunand)
Last sequence changes 2006-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: ZmPrx10 (Peroxidase17 / GRMZM5G843748)
Name (synonym) ZmPrx10 (Peroxidase17 / GRMZM5G843748)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Pericarps
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx10
start..stop
S start..stop
SbPrx31 605 0 1..335 1..337
SiPrx121 598 0 7..330 5..328
TmPrx07 552 0 25..327 23..325
TaPrx15 552 0 25..327 23..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 129362375..129362599 225 N° 2 129362041..129362232 192 N° 3 129358449..129359075 627  
complement(join(129358449..129359075,129362041..129362232,129362375..129362599))


exon

Literature and cross-references ZmPrx10 (Peroxidase17 / GRMZM5G843748)
Literature Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R. Maize peroxidase genes and their use for improving plant disease resistance and stalk strength
Protein ref. UniProtKB:   B6T750
DNA ref. GenBank:   AC206905.3 (32060..36207) [3' end]
mRNA ref. GenBank:   AX546775   EU960815
Cluster/Prediction ref. UniGene:   Zm.83413
Protein sequence: ZmPrx10 (Peroxidase17 / GRMZM5G843748)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347
PWM (Da):   %s   37823.74  
PI (pH):   %s   5.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVPRGCLGLPLVAVLLASLCRGQAAVRELKVGYYAETCPEAEDIVRETMARARAREARSVASVMRLQFHDCFVNGCDGSVLMDATPTMPGEKDALSNINSLRSFEVVDEIKDALEERCPGVVSCADIVIMAARDAVVLTGGPNWEVRLGREDSMTASQEDADNIMPSPRANASALIRLFAGLNLSVTDLVALSGSHSIGEARCFSIVFRLYNQSGSGRPDPHMDTAYRRSLDALCPKGGDEEVTGGLDATPRVFDNQYFEDLVALRGFLNSDQTLFSDNTRTRRVVERLSKDQDAFFRAFIEGMIKMGELQNPRKGEIRRNCRVANNSPWQPRTGMASGQSTSELR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, introns 1 and 2), 3 cDNA and 197 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATTCCCGAA CTACCCGAAC TGATGTGTTG GCTTTATAAA AACACATACA CCTTATTAAA TTAGTATAAA AATATAGTTT GAATAATGAT ATACATGGAC ATATAAAACA CAAGCAATCT  ACAATCACAA GTTATGCACA CTTACACATA ATTATAGATG TACAAATTAA TAATTAAGCA TGACATGAGT ACATGACACA TGAAAGTTCG GGTAGTTCGG TTATTTCGGA TACCCGATTG  TGATATCTGA ATTACCCAAA ATAAATTCGG GTTTTGCAAG GTGCTACCCG AAATTCATGA ACAAAATTCA GTTTTCGGGT ATTCCGGGTT CGGTTTCGGG TTATGGGTTT TTTGCCCAGC  TCTAGTTAGA CTCCAACTTG TAACCACCTC CACCATGAAC AAGAGACTTT GAAGCCTCCC CTCCTTCTCT CGCCCAGTTT GTACCCCCTA CTACAAGCTT TGATCAATGG TGTCAATAGC  GCAAGTCGTC GATGACTGGA TGTAGAGACA TTTTGCCCGA ACTAGTATAA ATCTTACGCA CACTACGCAC ATCGTATGGA GCCCGAAACG AACACAATAA AATTACTTAT CGGAGCACGG  TTCGAAAACA CCGCAAGTTG CTTTTAGTTG AAAACATTCA AACACCCCTA GCTAATAGTC CATCTAATTA TTAGCTTACC CTCAACTACC AATTAGTTAA TTAGCTGGTT CAACTCGACT  AAAATCAACT AATAGTTAGC CAGCTACGAG TTAGTCCGCT AATTTTACTA GTAATTTTTT AGCTAGCTAA CTAGTAGCAC TAGAACACTA ATGCATTCAA ACAGGTCTTA AGTCCTTTAT  GAGCACTAGC TAGATGTCTG TGTATTGCTA TGGATTTCTA TATATATCAT ATAGGTAGAC TTTGGTTTAA TAAAATAAAA AATATATATG TTATATTCGT TAGATGAGTT TAAATGTGGA  GTCAACAATC AATGTTCGAA CCCCATTTGT CACACAACAA CAAAACTGTG AAAATTGGTG TTTTACATAG TCGTTACATT TCATGCCTCC CACCTTTCAC ACCTTTGACC AAAATTTGAC  CAGAACAAGT ATTGTCCGTT ATTTTCACAA ATTTCCAAAA AAACTTGAGA AGTATTCCAG GCATATACAA TTTAAAGACC ATGGATCAAT CTTTAAAATA CGAGAGATAA CTAATAGACT  ACATGATATA ATTATGATTC TTTGGATCAT GAATAATGTT AAGTGACATT ATATATGGAG GCTTAGAGAG TCATGTAGAG ATATATTATT CGCAAAAAAA TATGCCTTTT GTGTTTTTAA  ATAACTTTTA GAGACTCTCG ACATACTCTG TATTAAATAG TTTTGCTAAG AAAAGAGTAC AACCGTCCGT CCTCCGTCCA CACAGTCACA GACGCGCAAA GAAAAATCCG GGTCAATGCT  CCCTCCTCCC CTGCCTGCCA ATAACCGGCC GTGCCATCGT GTACCGCCGC GACACGGTGC ACGATCGGAG CGCGGATATT TTTGAAGCGC GCGCGCGCAC GAACGTGAAC ACCGTTTGAC  CGAAGCCGTC GGACCCGGGC CGGCGCGTGC TAGTGGTGTA CAGTGTACTG TTTGGTCTTG GTGGTGTAGG AACGCTGACG CACCCGACTC GGCCGGCCGC GGCCTGGCGG CTGGCGGCGT  CCGCCCACCA CTGGCTGGCC ACAGCTCCCC GTGTCGCGCA CGGCCCCCGC TCCCTCCTCG CCAACCTCGT GCTGACAGCC CATTGGCCTC GGCCTGCAGC CAGCGGCTAT CGGCTAGCGG  CCAGCTTCCT TTTTATCAAC AACTACTACC CGCCGTGACC TCGCGAGTCG CGACCCGGAC GCGACTAGTA CACTGCCTGC CAAACAGCTG AGCAGAGTAG AGTAGAGCAG AGGGCGAAGT 
GCAGCGCAGT GTGCCCCGTC TCGGAACAGC GCGGACCACC AGAGCGTGCG CGTCCGTGCC CCACCCCTCC CTCTCTATCC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCCCGCGGGTGCCTCGGGCTCCCCCTGGTCGCCGTGCTCCTCGCGTCCCTCTGCCGCGGCCAGGCGGCGGTGAGGGAGCTCAAGGTCGGGTACTACGCCGAGACGTGCCCG
GAGGCCGAGGACATCGTCCGTGAGACCATGGCGCGCGCGCGCGCACGCGAGGCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GTGAGCCGCCCGCCC
GCCCCACGCATCTGATCTCGCTCCGGTTGCGCTACGTGGCTTCCTCCCTCCCTCCCTCCGCGCGCGGTCGATCTGACGCGATGGATTCTCTCTTCTGCTCCTTCCCGGTGGCGGGGGGCG
GCTGCAGGGGTGCGACGGCTCGGTGCTGATGGACGCCACGCCGACGATGCCCGGCGAGAAGGATGCGCTCTCCAACATCAACTCCCTGCGCTCGTTCGAGGTCGTCGACGAGATCAAGGA
CGCGCTGGAGGAGCGCTGCCCCGGAGTGGTCTCCTGCGCCGACATCGTCATCATGGCCGCCCGCGACGCCGTCGTCCTG
GTACGCGCCTCCCCCCCGCACCCTGCACGAGATCCGTTGCT
TTGTTTTGTTCACTTGGGCTATTCTCAATGCAAAATTTCTAACGTTGGAAATAAAAAATGCTATAAAACTAAGAATAAAAAAATAACTCCTGGGGTAAAATTCCGCTTCAATATTTCGTA
CACTACCATACACCATTAAATATTACAACTAAATGACCAACGCTTTTAGTGAAACATGTGAAGATGAAATAAACCACTAAATGAAAGTTTCAAACGAGGGTTTTACACTGTTTTCAAAAC
TTTGTAAACGAGATGACATGATTTTATTCCTATCAAACTAATTTTATCTTTTATAGAATCCATTAAACAAATATTATGTCATATCATCTAAAATTCTAATGTAACGTACGATTAAATGTA
TATGAAACCACCGTGAAACCAGACTGAGAGTAGCCTTAAACACCAGATATATGCGATACCGATGCACATGGTGTTTCTCTTGACCTGTCATGCGGTCTACCGTTTCCCATTCGCTTCCGC
TTTGTCTGCCGTTTCCTGTCCAAATCCTGCGTTTCTTTCTGCTCAGCTCTGTCTGCCGTTTGCACTCCCAAATCCAGCGTTTCCAGTGCAGAACCCAGCGTTGATGGTGCTCCCCACAGC
TTCCAGGATCCACTGTGAATAAAAGACAAGAGAAGAAATGAAGAATATCAATTAGAAAAGTTTTTTTTTCCACGAATTGCTTTTGCTGCCACGGCGCAGCGCTGCGCAGCGCTGTGGGCA
CGGCTGCTTCGTGCTGCTCCACAGCCAAGGCGGCGTGTGCCGGGCAAGGACCTGGCACCTCTAGCTTCATGTCGCGTTCTTCGGAACGCTTTTCGTGCCACTAGCCTTGCGTCGCGTTCA
ACCTTACGTTCACGTACAAAATGGGCATTCGAGGATTGTCCGCAAGTACAGAATATGGTTGGTGCCATGCCAATGCCAACCGCATCACTCGCGTGTGCGCAGCATGGCCAAGCATTCATC
GCTCCGTTTTACATTACATGTTTTATCTGCTTGGTGGGGGGGGGGGGGGGGGGAAATGCTTAGGTAGTTTCAATTATCTTCGTACTAATGGCTTTTATCGGGAAATCAATTGACGCTTTC
TAAATTTTAGAACAATAAAGGCATTTGATGTACAAGTTGGCAGGCAGGATCACGATCATTTTGCCTACCACTGACCATGGCACCTTACCATTGACGACATGGCGATGCATGCACGGTGCA
CATCCCAGTTAGGGCATGTTCGTTTAGACCAATCCAGAGGGGGATTGGAGAGGTTTAAATCCCCGTCTAGTCAAAAATGACTAGGCAGGGATTTAAACCCCTTCAATCCCCCTCTGGATT
GGTCTAACCGAACAAGCCCTTAGCTGTGCACCTGCAGGGCTGGGCATCACGCGCCTACCCACCCGGCTCGGCTCGCGTCGCGTGCACCTCACACCACCTGCCTCCCTCATGGGCCATATG
CAGACTACACAGAGAGGGAGAGCGCCAGAGACCCAGACGGCCAGACCAGACAGATGCGTAGTATATGCATTTGCCCGGGGAACAGAGGGCCACCGCATGGCGCACGGGCACCAAACGTCC
AACCCAGCCGGGAAAGGCCAGGCTCGACCCGCCGCGCGCACGAAAGGCGAGCGGACCCCCGTCCACGTGCCGCGGCGAGAGACGAGAGTGGTTCTAGGCTTCGGCGTTTAGCGCGGACAG
CTCGTATGGTGCTCCTCGGCCTCGGGTGCTGCTGCCACGGCCCACTGACCACTGGCGCCGCGAATAGCAAAGCTGCCGGCCCCTCCGTCGCCGAGGTGGGATTCTGTTTCTCCCAGATTG
GACGATGGCGGGGAAGAGATTTCCGTGGAATGGAGTACTTTTTCGCGTGCTTTTCCCTTGATCCTCACGAATGTTCGAATCGCGGCGTGGAAACAAGCGAGAAGCGACGATGCACAATGC
CGTCAGCGCTGATGCCTGGGAGGCTGGGTGGGAGGAACTGCAAGGATACGGTTCGCTCTTCTTGTTGACGGCAACGGCTGCTATGCAAGCGGGCGTGCAAGAGTGGTTCAACGGGATTGA
TTGGTGCAGGAGTCATATAGGAGTGCTACTAGTATTACGTAATCGTACGTACTACTAGTACAAAACCTGTCGATGTTCCTTGAAATGAAATGTAACTGTACTTGCAATTGAAAGATCAGA
TGGTTTTCATCAATTTTCAGCAAAAATAGATCTGTTCATCAGATGGTCGCGTAGTACCTCCCCCGTTTTTTTTAAGAAAATGGTCGTTGTACTTTGCTTAAATGTAGTGTGGGTGTGGCA
CGGGTAGAAGTGACAATGAGCTCTAAATTTTACATTATAAATTTTAAGAATTAGATTAAGTTCGAGCTCTATTTCTAATCATTTTTGAACTAAAATAATTTAGGGATTTAATAAATTGTG
AAAAAGCATTTATATCATTGACCCATTGCCACTCCTAGACACTCCAATTTTGTTTCGACTTTTTTTTTGACGCAAAGAAAAAACTGAGATCATATGAATGCTGCGCCGTCCGTTATTGTC
AGTAAAGAGTCTGCATTGGCTTACGAATGAGAATGTACTTCTCCGTTAGTTATTTTTTTAAAAAAATAGCAGACGACAAATATTCAAAAATAGAGATAGTATATTGCTATTACTAATATA
TAGTAATGTTGGACCTACTATCTCCATCTAGAAAATGGAAATGGCACTTCCGGTTGAACTAAATAATCTCAGATTTGACTATATTAATATTGTATCTTTAAATAATTTTGCTATAAAAAT
ATATTTTGCAATTAATCTAGTAATACTTATTGCACACTTGTAGTAGATATTATTGTTTTTATATATATTTAGTCAAACTTGATATCGTTTCTATGTGACTGAAGAGTGGGTCAGATCGTT
TGACGTCATCTGACTCTTTCATCTGTTCGGATATGTTGTCACAGACCGGTGGGCCTAACTGGGAGGTGCGGCTCGGGCGCGAGGACAGCATGACGGCGAGCCAGGAGGACGCGGACAACA
TCATGCCGAGCCCGCGCGCAAACGCGAGCGCTCTCATCCGGCTCTTCGCGGGGCTCAACCTCAGCGTCACCGACCTGGTCGCGCTCTCGGGCTCGCACTCCATCGGCGAGGCCCGCTGCT
TCTCCATCGTCTTCCGCCTCTACAACCAGTCTGGATCCGGCCGCCCCGACCCGCACATGGACACCGCCTACCGCCGCTCGCTCGACGCACTCTGCCCCAAGGGCGGCGACGAGGAGGTCA
CGGGAGGCCTAGACGCCACCCCACGCGTCTTCGACAACCAGTACTTCGAGGACCTCGTCGCGCTCCGCGGCTTCCTCAACTCCGACCAGACGCTCTTCTCTGACAACACCAGGACCCGTC
GCGTCGTCGAGCGGCTCAGCAAGGACCAGGACGCCTTCTTCAGGGCCTTCATCGAGGGGATGATAAAGATGGGGGAGCTCCAAAACCCCAGGAAAGGGGAGATACGGCGCAACTGTCGCG
TTGCTAACAACTCGCCGTGGCAACCAAGGACGGGGATGGCGTCCGGACAGTCGACATCTGAGCTCCGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCCCGCGGGTGCCTCGGGCTCCCCCTGGTCGCCGTGCTCCTCGCGTCCCTCTGCCGCGGCCAGGCGGCGGTGAGGGAGCTCAAGGTCGGGTACTACGCCGAGACGTGCCCG
GAGGCCGAGGACATCGTCCGTGAGACCATGGCGCGCGCGCGCGCACGCGAGGCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GGGTGCGACGGCTCG
GTGCTGATGGACGCCACGCCGACGATGCCCGGCGAGAAGGATGCGCTCTCCAACATCAACTCCCTGCGCTCGTTCGAGGTCGTCGACGAGATCAAGGACGCGCTGGAGGAGCGCTGCCCC
GGAGTGGTCTCCTGCGCCGACATCGTCATCATGGCCGCCCGCGACGCCGTCGTCCTG
ACCGGTGGGCCTAACTGGGAGGTGCGGCTCGGGCGCGAGGACAGCATGACGGCGAGCCAGGAG
GACGCGGACAACATCATGCCGAGCCCGCGCGCAAACGCGAGCGCTCTCATCCGGCTCTTCGCGGGGCTCAACCTCAGCGTCACCGACCTGGTCGCGCTCTCGGGCTCGCACTCCATCGGC
GAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCTGGATCCGGCCGCCCCGACCCGCACATGGACACCGCCTACCGCCGCTCGCTCGACGCACTCTGCCCCAAGGGCGGC
GACGAGGAGGTCACGGGAGGCCTAGACGCCACCCCACGCGTCTTCGACAACCAGTACTTCGAGGACCTCGTCGCGCTCCGCGGCTTCCTCAACTCCGACCAGACGCTCTTCTCTGACAAC
ACCAGGACCCGTCGCGTCGTCGAGCGGCTCAGCAAGGACCAGGACGCCTTCTTCAGGGCCTTCATCGAGGGGATGATAAAGATGGGGGAGCTCCAAAACCCCAGGAAAGGGGAGATACGG
CGCAACTGTCGCGTTGCTAACAACTCGCCGTGGCAACCAAGGACGGGGATGGCGTCCGGACAGTCGACATCTGAGCTCCGGTGA

Retrieve as FASTA