Entry information : ZmPrx13
Entry ID 176
Creation 2009-01-13 (Christophe Dunand)
Last sequence changes 2009-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx13
Name ZmPrx13
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx13
start..stop
S start..stop
SbPrx19 567 0 1..334 1..332
SiPrx153 548 0 28..334 28..332
BdiPrx45 514 0 19..334 22..334
OsPrx38 493 2e-177 11..334 10..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31250778..31251014 237 N° 2 31250416..31250598 183 N° 3 31250134..31250299 166 N° 4 31249577..31249995 419
complement(join(31249577..31249995,31250134..31250299,31250416..31250598,3125077 8..31251014))


exon

Literature and cross-references ZmPrx13
Literature REFERENCE 1 Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R. Maize peroxidase genes and their use for improving plant disease resistance and stalk strength.
REFERENCE 2 Collura,K., Wissotski,M., Campos,D., Kudrna,D., Golser,W., Ashely ,E., Haller,K., Wing,R., Soderlund,C., Walbot,V. and Yu,Y. Maize Full-length cDNA Project.
DNA ref. GenBank:   AC190506.1 (1453455..143987)
EST ref. GenBank:   EC900397 [5' end]
Cluster/Prediction ref. UniGene:   Zm.37967
Protein sequence: ZmPrx13
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   34792.18 Transmb domain:   %s   i13-30o
PI (pH):   %s   5.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERKSFSCRDTASCLALLAVALCLGAATVARGQLTDDFYDDCCPQAENIVRARVSAAMKAEPRMGASLLRLHFHDCFVNGCDGSILLDGNNTEKLAGPNLNSARGFDVVDAIKADLEKACPGVVSCADILAIAAKYGVLLSGGPDYDVLLGRRDGLVANQSGANSNLPSPFDPISTITKKFSDVGLNTTDVVVLSGGHTIGRARCVLFSGRLANFSATSSVDPTLNASLASSLQALCRGGDGNQTAALDDGSADAFDNHYYQNLLGQRGLLSSDQGLFSSTDGSAATTRALVQAYSASSERFFCDFGRSMLKMGNILPLTGSAGQIRSNCRAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 3 ESTs. Cultivar="B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCGCAAATCATTCTCCTGCAGAGACACTGCGAGCTGCCTCGCCCTGCTCGCCGTCGCGCTGTGCCTCGGCGCCGCCACGGTGGCGCGGGGCCAGCTGACGGACGACTTCTACGAC
GACTGCTGCCCCCAGGCGGAGAACATCGTGAGGGCGCGCGTGTCCGCCGCGATGAAGGCCGAGCCCCGCATGGGCGCCTCCCTGCTCAGGCTCCATTTCCACGACTGCTTCGTCAAC
GTA
CGTACGATGATCAAGACGCCACGCACACGCGCTCTGTTCTGTTGAGAGTCATGCGGGCACACAGCGCGAGTGCTCCCAGTCTTGAGCCTAGCTAACTCCCAGCTAAGTATATATGTGTAC
CGAATATTTGGTCGCTGAAAAGGACTTGCTCGCTGCATGCACGCACGTACACGCAGGGGTGCGACGGGTCGATCCTGCTGGACGGGAACAACACCGAGAAGCTGGCGGGGCCGAACCTGA
ACTCGGCGCGCGGCTTCGATGTCGTCGACGCCATCAAGGCCGACCTCGAGAAGGCGTGTCCCGGGGTCGTCTCCTGCGCCGACATCCTCGCCATCGCGGCAAAGTACGGAGTGCTGCTG
G
TGCGTCCCTTCCCTCATGATTTCAGTACTACGATACTTGGTGCTTGGGGCCGGCCATGCATCCATAGATCCGTCGCGCTGAAAAAGAAAACCTGTACTGTACTGTACTGACGCAGAGCGG
AGGGCCGGACTACGACGTGCTGCTGGGAAGGAGGGACGGCCTGGTGGCAAACCAGTCCGGCGCCAACAGCAACCTGCCTAGCCCGTTCGATCCCATCAGCACCATCACAAAGAAGTTCAG
CGATGTGGGTCTCAACACAACCGACGTGGTCGTTTTATCAG
GTACCGTAGTACGCATCTTAATTTCACTGCACAACACTACTTCGTCCCTCTCCGTCCCTACTAGCTGAACTGACCTGGC
GTCAGTAAGAGCGATGATGGTGACTGCATAACTAACTGGACGGACGGACACGCACGCAGGAGGCCACACGATCGGGCGAGCGCGGTGCGTGCTGTTCAGCGGCCGGCTGGCCAACTTCTC
GGCGACGAGCTCCGTGGACCCGACGCTGAACGCGTCCCTGGCGTCCAGCCTGCAGGCGCTGTGCCGGGGCGGGGACGGCAACCAGACGGCGGCGCTGGACGACGGCTCCGCCGACGCGTT
CGACAACCACTACTACCAGAACCTGCTGGGCCAGAGGGGCCTCCTGTCCTCCGACCAGGGCCTCTTCTCCAGCACCGACGGCAGCGCGGCCACCACCAGGGCGCTCGTCCAGGCCTACAG
CGCCAGCAGCGAGCGCTTCTTCTGCGACTTCGGCAGGTCCATGCTCAAGATGGGCAACATCCTCCCGCTCACCGGCTCCGCCGGCCAGATCCGCAGCAACTGCCGTGCCATCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCGCAAATCATTCTCCTGCAGAGACACTGCGAGCTGCCTCGCCCTGCTCGCCGTCGCGCTGTGCCTCGGCGCCGCCACGGTGGCGCGGGGCCAGCTGACGGACGACTTCTACGAC
GACTGCTGCCCCCAGGCGGAGAACATCGTGAGGGCGCGCGTGTCCGCCGCGATGAAGGCCGAGCCCCGCATGGGCGCCTCCCTGCTCAGGCTCCATTTCCACGACTGCTTCGTCAAC
GGG
TGCGACGGGTCGATCCTGCTGGACGGGAACAACACCGAGAAGCTGGCGGGGCCGAACCTGAACTCGGCGCGCGGCTTCGATGTCGTCGACGCCATCAAGGCCGACCTCGAGAAGGCGTGT
CCCGGGGTCGTCTCCTGCGCCGACATCCTCGCCATCGCGGCAAAGTACGGAGTGCTGCTG
AGCGGAGGGCCGGACTACGACGTGCTGCTGGGAAGGAGGGACGGCCTGGTGGCAAACCAG
TCCGGCGCCAACAGCAACCTGCCTAGCCCGTTCGATCCCATCAGCACCATCACAAAGAAGTTCAGCGATGTGGGTCTCAACACAACCGACGTGGTCGTTTTATCAG
GAGGCCACACGATC
GGGCGAGCGCGGTGCGTGCTGTTCAGCGGCCGGCTGGCCAACTTCTCGGCGACGAGCTCCGTGGACCCGACGCTGAACGCGTCCCTGGCGTCCAGCCTGCAGGCGCTGTGCCGGGGCGGG
GACGGCAACCAGACGGCGGCGCTGGACGACGGCTCCGCCGACGCGTTCGACAACCACTACTACCAGAACCTGCTGGGCCAGAGGGGCCTCCTGTCCTCCGACCAGGGCCTCTTCTCCAGC
ACCGACGGCAGCGCGGCCACCACCAGGGCGCTCGTCCAGGCCTACAGCGCCAGCAGCGAGCGCTTCTTCTGCGACTTCGGCAGGTCCATGCTCAAGATGGGCAACATCCTCCCGCTCACC
GGCTCCGCCGGCCAGATCCGCAGCAACTGCCGTGCCATCAACTGA

Retrieve as FASTA