Entry information : OsAPx01 (APX1)
Entry ID 1865
Creation 2006-09-04 (Christophe Dunand)
Last sequence changes 2006-09-04
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsAPx01 (APX1)
Name (synonym) OsAPx01 (APX1)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Cytosolic
Tissue types Callus
Flowers
Leaves
Pannicles
Radicles
Roots
Seedlings
Spikes
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx01
start..stop
S start..stop
TaAPx05 485 4e-177 1..250 1..250
HvAPx02 482 8e-176 1..250 1..250
TmAPx01 481 1e-175 1..250 1..250
BdiAPx02 481 2e-175 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9813510..9813628 119 N° 2 9813724..9813898 175 N° 3 9813993..9814058 66 N° 4 9815415..9815463 49
N° 5 9815797..9815882 86 N° 6 9815969..9816048 80 N° 7 9816144..9816246 103 N° 8 9816364..9816422 59
N° 9 9816509..9816524 16  
join(9813510..9813628,9813724..9813898,9813993..9814058,9815415..9815463,9815797 ..9815882,9815969..9816048,9816144..9816246,9816364..9816422,9816509..9816524)


exon

Literature and cross-references OsAPx01 (APX1)
Literature Morita,S., Kaminaka,H., Yokoi,H., Masumura,T. and Tanaka,K. (1997) Cloning and characterization of cytosolic ascorbate peroxidase cDNA from rice (PGR97-012). Plant Physiol 113:306.
Protein ref. UniProtKB:   Q10N21
DNA ref. GenBank:   NC_008396.1 (9813510..9816521)
mRNA ref. GenBank:   D45423.1
Cluster/Prediction ref. UniGene:   Os.12723
Protein sequence: OsAPx01 (APX1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27067.68  
PI (pH):   %s   5.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKNYPVVSAEYQEAVEKARQKLRALIAEKSCAPLMLRLAWHSAGTFDVSSKTGGPFGTMKTPAELSHAANAGLDIAVRMLEPIKEEIPTISYADFYLAGVVAVEVSGGPAVPFHPGREDKPAPPPEGRLPDATKGSDHLRQVFGAQMGLSDQDIVALSGGHTGRCHKERSGFEGPWTRNPLQFDNSYFTELLSGDKEGLLQLPSDKALLSDPAFRPLVEKYADEKAFFEDYKEAHLKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 8 introns) and 130 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGAACTACCCCGTCGTGAGCGCCGAGTACCAGGAGGCCGTCGAGAAGGCCAGGCAGAAGCTGCGCGCCCTCATCGCCGAGAAGAGCTGCGCCCCTCTCATGCTCCGCCTCGCG
TAAGCCGTCGCCCTCGCACTCGCTCGCTTCTAGGTTTTGTGTAGAGGCGGATTTCCGTAGACTGATCCGGTTTTTGTGGAGACGGATCGCGCAGGTGGCACTCGGCGGGGACGTTCGACG
TGTCGTCGAAGACCGGGGGCCCGTTCGGGACGATGAAGACCCCGGCGGAGCTGTCGCACGCCGCCAACGCGGGGCTGGACATCGCGGTGCGGATGCTCGAGCCCATCAAGGAGGAGATAC
CCACCATCTCCTACGCCGATTTCTACCAG
GTTCGCCGCGAGCCCCGGATAGATCTGGATGGACGGCCCCGATCTGGTCAAACGGACGTGGTTCTGATGTTTTTTCCCCGTTGTTTTTGCG
CAGCTTGCCGGAGTTGTGGCCGTCGAGGTGTCCGGTGGACCTGCCGTCCCCTTCCACCCAGGAAGGGAGGTGAGATTTCCTATTACCTTTCAACTCTTGGGGTTTTTCTCAGGGTTCTAG
TTAGGCCTTGATATGGCAGTGGTAAACTGGATGGCGTGTGGATTTGTTTGTGATGCCACGAGATTAGTCGTAATTTGTTAGTGCTCCATTGATGTGTGTGCTTTTCATTTGTGGGGACTG
GGGGTTGGTGGTTCCTAGAGAGTAGACAAAGTGATCACCACTAATCTAAGGCCAGCAGTATAATAATATTTTAACAGTACGGACTTTTCTATATTATATACCCGGATAATACCGTCAAAT
TGGGTTTGTTCGTATTCTTGTTGGTGGGTCGGCGTTACTTGACATCCTCTAGATCTAGAGGTGGTTAAATATCCGTGACCTCATTTACATTTCCGTAAGACCTTGTTTATTTACCATAAA
CATGCTAATTGTTATTTTTTAGTTATTGTTGGCTCATGTGTTTGTGTCAGTTGAGTCACATAGGATTCATTTTCATGCATGCTGTATGGTGTGAAGTTTGTTATCCATTCATGCACAAGG
ATATTATTTTTAAGGATGTCGCCTTATCCTTTTTCTTTGTAGTCTGGCTATTCTCAAAGTAGTCACTGATTTACCATGGTTGTTTGCGGCATTTCCCTGTTCAGGGTTTTGATAGTTACT
GATCTTTCATTTTATCATTTTTATTTTTTACTCAGGATAGTAGTTCTCATCCTAATCGATGTCATACTCTAAACCATGACAAATAAACAATTATTTTCTGAATTAATGGAAGAAGCCTTG
GGGACCTGGAAGAAGCCTTGGGGACCGGGGTTGTTTCCGTTCTCTATGCATGATATAGTTTGATCTGTTGGATTGTGCCATGTAGGATATTTGTTGTGCTTTGTGAATATAAACTTAAGA
AAGCATCCATTATTTACAAGTCTAGTTGGTTCAGATAAAGTATATTAGGGCCTCCCAACTTATTGCATTGACATAAAATGATAATTAGGGGTTCAATCTGAAGGCAGTTGGAAAGCTTAA
TGAAAAAACAGTGGGCCGATATATATCTATATGTTATGTTTTAGGAAACTTTAGAAAGGTGACTTGGTGCTTGTTTTAGGATATAATAACTGTTATGGATATATCTTTTTTTATAAATAC
ATAATGTTCAGTAATTATTATGCACCTTCAACAATATCACCGATGATAGTAATATATATCATATATGTAACATTATACAGTGCTTAAAATTTGCTTGTGCATATCTGGCTCATCTTTATA
TTTATTTCTAAAATGGAGAGATGATTAAGTGTTTTTTTATGTTCCATTTTATATTCATTGTGTTGTTAATTGAGATTGTTTTCATCCTTCCTTGACCTTTTGCAGGACAAACCTGCACCC
CCACCTGAGGGCCGTCTTCCTGATGCTACCAAGG
GTATGTTGCCAGTTTACACTACTAGTCTCTTCCAGGAACTATAGAAACATTCACCACTATTGCCATAAAAGAAACCCTTGCAAATA
AGTCATCCTTTAAAATGTTTTTGTTTCTGCAATAGTTGAGGTGTTATTTCTGTGTAGCACATCTAAAATGCTTAGTTATGGTAGAAGTTTTTCCCACTGCACACTTGACAAATGATTCCT
GTGTTGTTGTAGGCATGTTGTATTTTTCTGCATGCTTCATTTCTGATATGATCCTGCTTTGACCTTGTTCTAGTAAACCTCATGTAAAGCACCATTGCTTACACTTTGAGCTTGATTGCT
TTACCAGGTTCTGACCACCTAAGGCAGGTCTTCGGTGCGCAGATGGGCTTGAGTGATCAGGACATTGTTGCCCTCTCTGGCGGTCACACCCTGGTTAGTTTGGCTATTAACCATTGTATG
CCTCTGCAGTATGTAGGAGTACATGTTCTAATGTCGGATTTCTGTGCTTTGTTCTGCAGGGAAGGTGCCACAAGGAAAGATCTGGTTTTGAGGGACCTTGGACAAGAAACCCTCTGCAGT
TTGACAACTCTTACTTCAC
GTAAGCGATGTTACGAGTGGTTGAATTTTGTTCTTATGCTGAACAAAGTTGGTAACAAAAATGTTGAACTCATCTCTCCGCGACGATTTTAATAGGGAGCT
TCTGAGTGGTGACAAGGAGGGCCTTCTTCAGCTTCCTAGTGACAAAGCCCTGCTGAGTGACCCTGCCTTCCGCCCACTCGTCGAGAAATATGCTGCA
GTATGTCTCCTATCAATCATCAT
CTTGTGTTCCACGTTTTGCATCTTGTGTTCCTCGTTTTGCAGAGATATGCCAGAACATGATACTGATTGTGTTTTTTTTCCCCAATTCTGCTAGGATGAGAAGGCTTTCTTTGAAGACTA
CAAGGAGGCCCACCTCAAGCTCTCCGAACTGGG
GTGAGTAATGGTTTGTCAATCCATTTATCGTGTTATCTTTCATGACAACAAGGTCATGGTAGCTAATTGTACTCTTGTGATTTCAGG
TTCGCTGATGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGAACTACCCCGTCGTGAGCGCCGAGTACCAGGAGGCCGTCGAGAAGGCCAGGCAGAAGCTGCGCGCCCTCATCGCCGAGAAGAGCTGCGCCCCTCTCATGCTCCGCCTCGCG
TGGCACTCGGCGGGGACGTTCGACGTGTCGTCGAAGACCGGGGGCCCGTTCGGGACGATGAAGACCCCGGCGGAGCTGTCGCACGCCGCCAACGCGGGGCTGGACATCGCGGTGCGGATG
CTCGAGCCCATCAAGGAGGAGATACCCACCATCTCCTACGCCGATTTCTACCAG
CTTGCCGGAGTTGTGGCCGTCGAGGTGTCCGGTGGACCTGCCGTCCCCTTCCACCCAGGAAGGGAG
GACAAACCTGCACCCCCACCTGAGGGCCGTCTTCCTGATGCTACCAAGGGTTCTGACCACCTAAGGCAGGTCTTCGGTGCGCAGATGGGCTTGAGTGATCAGGACATTGTTGCCCTCTCT
GGCGGTCACACCCTG
GGAAGGTGCCACAAGGAAAGATCTGGTTTTGAGGGACCTTGGACAAGAAACCCTCTGCAGTTTGACAACTCTTACTTCACGGAGCTTCTGAGTGGTGACAAGGAG
GGCCTTCTTCAGCTTCCTAGTGACAAAGCCCTGCTGAGTGACCCTGCCTTCCGCCCACTCGTCGAGAAATATGCTGCA
GATGAGAAGGCTTTCTTTGAAGACTACAAGGAGGCCCACCTC
AAGCTCTCCGAACTGGG
GTTCGCTGATGCTTAA

Retrieve as FASTA