Entry information : OsAPx04 (APX4)
Entry ID 1868
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2006-09-05
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsAPx04 (APX4)
Name (synonym) OsAPx04 (APX4)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Peroxisomal
Tissue types Callus
Flowers
Leaves
Pannicles
Roots
Seeds
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx04
start..stop
S start..stop
SbAPx04 530 0 1..291 1..289
TaAPx06 526 0 1..291 1..291
ScAPx04 526 0 1..291 1..291
HvAPx01 526 0 1..291 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27551842..27551954 113 N° 2 27550762..27550886 125 N° 3 27550254..27550303 50 N° 4 27550028..27550093 66
N° 5 27549899..27549947 49 N° 6 27549245..27549327 83 N° 7 27549074..27549153 80 N° 8 27548876..27548978 103
N° 9 27548328..27548534 207  
complement(join(27548328..27548534,27548876..27548978,27549074..27549153,2754924 5..27549327,27549899..27549947,27550028..27550093,27550254..27550303,27550762..2 7550886,27551842..27551954))


exon

Literature and cross-references OsAPx04 (APX4)
Literature Kikuchi,S. et al. (2003) Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice.Science 301 (5631), 376-379.
Protein ref. UniProtKB:   Q6ZJJ1
DNA ref. GenBank:   NC_008401.1 (27551954..27548331)
Cluster/Prediction ref. UniGene:   Os.10609
Protein sequence: OsAPx04 (APX4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   291
PWM (Da):   %s   31590.35 Transmb domain:   %s   o262-284i
PI (pH):   %s   7.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPVVDAEYLRQVDRARRHLRALISSKGCAPIMLRLAWHDAGTYDVNTKTGGANGSIRYEEEYTHGSNAGLKIAIDLEPIKAKSPKITYADLYLAGVVAVEVTGGPTVEFIPGRRDSSVCPREGRLPDAKKGALHLRDIFYRMGLSDKDIVALSGGHTGRAHPERSGFEGAWTQEPLKFDNSYFLELLKGESEGLLKLPTDKALLEDPSFRRYVDLYADEDTFFKDYAESHKKLSELGFTPRSSGPASTKSDLSTGAVLAQSAVGVAVAAAVVIVSYLYEASKKSK*

Retrieve as FASTA  
Remarks Complete sequence from 6 mRNA, 167 ESTs and 1 genomic (Chromo 8, 8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCCCGGTCGTGGACGCCGAGTACCTCCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCTCCAAGGGATGCGCGCCCATCATGCTCCGCCTCGCGTACGTA
CCTACCGGCCTACCCCCCATCTCCTGCTCCTCCTAGAACCCTCCCCTAGTTCCTAATCCTTGTGATGGATTCGCGCGGCGGTGGCGAGGGAGGGAGCTCTCGTGTGTTTGGATTTGGAGC
CCGCTCGGCTCTGCTTGCCTCGAGTGGTGGGATGAGTTACTGCTGGTGGTGGTGAGATGGGTCGCTTGCGATTGCGAGACTGTATGATTGGGTTTGGTTAGTTGCTTGCGGCGGGTACCT
GCGCTGGTCCGTGGCGTGGCTGTTGGGCGAGGCAATTCGACGAACACCTTGAGTGCGTGCGCGCCTGCTTTGGATGGCTCCCAGATTTGGTTTTGATTGTGTGACTGCGCCTTTGGAATT
AACGAGGAACGGCGGACGATGTTTAGTTCGCTAGTTCACATGTAGAGTGCACGCGTTTTTCTGTTGATCCGTTGGTTCTCTCATACTAGTCAGGAAACTAGCAACCTAGCAGGGGAGAGC
GAGCATTTTTAATCACTCCCCATATTCCGTCATAACGGCAATATCGCAGGAAGCTAAGACGAATTTCTTATTTCTGTCTATAGTAGGTGTTCCACTCCATGAGCTTCGTGTTACATTTGT
GGAGCTGATGAGAGACCAGTGTTACAAACTGGAACAAATAAGTGATGTTTCATTATCTAAAAAAAGGGGATGTTTGCACTACTGCTGCAAATGTTCTATGTATATTGTAATTACGAATGG
ACTCAGAAGAAGCATTACCATTTAACGCACCATTACAGATAGTGCAGCGTGTATTTGCTAATTAATTAGTACTTTATATATGGAATTGTGATTTTTTTTATCTTATATGTTGTATACAGT
GTTCTTCTGTAATGTACTATGAGTTTTTCTCATTTATCATGGAGGATATTCTGCGTGCTCTTGGATTACTCTTGGACTAAAACTTAGTTCCTGTGCACTCCCTTGCAGATGGCATGACGC
GGGCACTTATGACGTGAACACAAAAACTGGTGGTGCAAATGGTTCAATTAGATACGAGGAAGAGTACACTCACGGTTCAAATGCTGGTCTAAAGATTGCTATTGATCTTCTCG
GTATGTA
TTGTTTGTCCCCAATGTGTTCCTAGATGATTAGACGAAAGTAGCTTTCACTTTTCCCCCATTGTCAGAATGGCTCTAGTTCCCTTTAAACCACTCATCAGCTATATGATTGATGCCTCTT
AAGAAATCAATTTGAGTTTTCTTGTCAGTTTCTCAAAATTCTTTTCTTTTTCTATTGTTTTGGGTTTTACCTTGATCGGACTACAAACTAACTCTTTTTTTTCTCTAATTCGGGGATCAA
ATATTTTGGGAGAAATAACTAAAAAACAAGAAACTCCCATATTTTTGCAACTATTCTCAATGGTGTTGCAGTACTCACCACTCTTCTCTGTACAATTGCATTATTTACCTGTTCCACGTT
ATCTAGTTTATTGTTATATTGTCACTTTATTCAGTGATGAAATAAATCGAATGATTACTTATGCTTCTCCAATTGTCTTTTACTGTAACAGAGCCTATTAAAGCCAAGAGCCCTAAGATC
ACATATGCTGACCTTTATCAG
GTAAATTAGCGTTGCTTGAATTGGTTCTTGTGCTGCCAACTTATTATAAGAGTGCCTTGATACTGTGACATCTTTTTTTTTTCTTGTCGCACATTTGAT
CTTTTTTATCTTATCGATTACTGTGTAAATTTTTAAGATCCTAACTAGATTTTTCTTACAGCTTGCTGGAGTTGTTGCAGTTGAAGTTACTGGGGGTCCAACTGTTGAGTTCATTCCTGG
AAGACGT
GTACGTGAAATAACATTTCTTTATGAATGGATGCATCTTTTATTGATTCACACTTATTAAGTTCTTTTGACCTGAATCAGGATTCGTCAGTTTGCCCCCGTGAAGGGCGTCTT
CCTGATGCTAAGAAAG
GTAATTGCCACAAACTATTCTTTGAACTGGTCTACCTTTTCTTTTGTCATTATAATCATGCTTCCTGACTCCTAGTGTTTGAAGCAATGAGTCAAAATATGTGT
TAGTATTCTACATGTATCACATTTAGTCCCATGCATTTCTCCTGTACTTGTCTGCTAGTACTCATGTTCTGGCATTTAGTACTTAGTGTTGCTTGAGACAACCCAGTTCATGCAATACAT
ACCGTAATATGTACATTATCTTAAACACACATACATCTCTTCATAGATGGGAGCCTCGTCTTTCATTTATCTTATATTCCTGCATATCTGGTATAGTTGTCATTTAGGTGTCATACCAGC
AGGTGCTGTTGTATGTCTGGTAATTTGTTTTATGTTATTTATCTGTTTTCCTATTCCTTCTGCCGAAGTCTGTTTTCCTTTCTTACATTTACTGGGATGCAAGGTGCCAGTTCCTATTTT
AGTATTTTAATAACTGGTGCCAGAATCCTGTTTTGATATGTATAATCGTAATCATATATCTATTTTTATGGGGGTATATCTGCATTTTATCTTTGTTTCATGAGCAGGTGCACTGCACTT
GAGGGACATCTTTTACCGGATGGGCTTATCAGACAAAGATATAGTAGCTTTATCTGGGGGTCACACTCTG
GTAAATGCTCTAATTAATGTAGAATTTGTGTAATGGTAATCCTGATTCTT
CATGAGAAGCACAGTTTTAACAACTCGCTTTATACTTCAAGGGAAGGGCACATCCTGAAAGGTCTGGATTTGAAGGCGCATGGACTCAGGAGCCTCTGAAGTTTGACAATTCGTACTTTC
T
GTAAGTTGAATACAAAACTGGGTCATTTACGTACTAATTCTGGGCACTAGATTTGAGGTTAGAAGATAACAGTGTAATATTTTATTTAACTGCAGTGAGCTACTGAAGGGGGAATCTGA
GGGGCTTCTGAAGCTCCCAACTGACAAGGCATTGTTGGAAGATCCTTCATTTAGACGCTATGTGGATCTTTATGCCAGG
GTAAAAAGGATCTTTTATATATATATTTTTTTTCTATTCCT
TGCACTTAAAACTCCCCCATTTTATATGCCCTTTCATCCATTTTTTAGGACTATAGGACCATTAACAAACTATAAAGTATTTGAATTTGTTAGTTGAAAATGCAATTAATAGATTTATTT
ATTGTCAAATATGATTTCGGAGCATTATATTTTTACAACTTTTACTGCTATATAATTGGAAGTGAATAATTTTCAAAATGCTACAAGAACTGTGAATATTTCATGCCGACGTACTATGCC
TTGCGGTGCTCCATAATATAAGTTTTACATTCAGAACCATTTCTTCTGTTCATATGGCAGGATGAAGACACCTTCTTCAAGGACTACGCTGAATCGCACAAGAAGCTTTCTGAACTTGGC
TTCACTCCACGGAGCAGCGGCCCTGCATCTACGAAATCTGATCTTTCAACTGGTGCTGTACTCGCACAGAGTGCTGTCGGGGTAGCTGTTGCTGCAGCTGTAGTTATCGTGAGCTACCTA
TACGAGGCTTCTAAGAAGAGCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCCCGGTCGTGGACGCCGAGTACCTCCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCTCCAAGGGATGCGCGCCCATCATGCTCCGCCTCGCATGGCAT
GACGCGGGCACTTATGACGTGAACACAAAAACTGGTGGTGCAAATGGTTCAATTAGATACGAGGAAGAGTACACTCACGGTTCAAATGCTGGTCTAAAGATTGCTATTGATCTTCTCG
AG
CCTATTAAAGCCAAGAGCCCTAAGATCACATATGCTGACCTTTATCAG
CTTGCTGGAGTTGTTGCAGTTGAAGTTACTGGGGGTCCAACTGTTGAGTTCATTCCTGGAAGACGTGATTCG
TCAGTTTGCCCCCGTGAAGGGCGTCTTCCTGATGCTAAGAAAG
GTGCACTGCACTTGAGGGACATCTTTTACCGGATGGGCTTATCAGACAAAGATATAGTAGCTTTATCTGGGGGTCAC
ACTCTG
GGAAGGGCACATCCTGAAAGGTCTGGATTTGAAGGCGCATGGACTCAGGAGCCTCTGAAGTTTGACAATTCGTACTTTCTTGAGCTACTGAAGGGGGAATCTGAGGGGCTTCTG
AAGCTCCCAACTGACAAGGCATTGTTGGAAGATCCTTCATTTAGACGCTATGTGGATCTTTATGCCAGG
GATGAAGACACCTTCTTCAAGGACTACGCTGAATCGCACAAGAAGCTTTCT
GAACTTGGCTTCACTCCACGGAGCAGCGGCCCTGCATCTACGAAATCTGATCTTTCAACTGGTGCTGTACTCGCACAGAGTGCTGTCGGGGTAGCTGTTGCTGCAGCTGTAGTTATCGTG
AGCTACCTATACGAGGCTTCTAAGAAGAGCAAGTAA

Retrieve as FASTA