Entry information : OsAPx05
Entry ID 1869
Creation 2006-06-28 (Christophe Dunand)
Last sequence changes 2010-08-03 (Marie Brette (Scipio))
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsAPx05
Name OsAPx05
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Stromal
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx05
start..stop
S start..stop
OsAPx06 541 0 1..320 1..309
SiAPx06 535 0 4..320 3..311
TaAPx03 534 0 4..320 3..313
HvAPx05 530 0 4..320 3..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3962880..3962969 90 N° 2 3962647..3962778 132 N° 3 3962223..3962343 121 N° 4 3962041..3962141 101
N° 5 3961854..3961941 88 N° 6 3960764..3960831 68 N° 7 3960590..3960676 87 N° 8 3960315..3960389 75
N° 9 3960158..3960235 78 N° 10 3959954..3960058 105 N° 11 3959843..3959860 18  
complement(join(3959843..3959860,3959954..3960058,3960158..3960235,3960315..3960 389,3960590..3960676,3960764..3960831,3961854..3961941,3962041..3962141,3962223. .3962343,3962647..3962778,3962880..3962969))


exon

Literature and cross-references OsAPx05
Literature Kikuchi,S. et al. (2003)
Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice. Science 301 (5631), 376-379.
Protein ref. UniProtKB:   Q2QWY1
DNA ref. GenBank:   NC_008405.1 (3962969..3959846)
Protein sequence: OsAPx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320
PWM (Da):   %s   34608.76  
PI (pH):   %s   6.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVVHRILRRGLSAASPLPSLRGLLLVSPQELGRRPASSSSSAAAAAGDVEAELRAAREDVRQLLKSNPCHPILVRLGWHDAGTYDKNITEWPKCGGANGSLRFGVELVHAANKGLLKALFLVIPIKSKYAGVTYADIFQLASATAIEAGGPKIPMIYGRADVADGEECPPEGRLPAADPPSPAEHLREVFYRMGLSDEIVALSGAHTLGRARPERSGWGKPETKYTENGPGAPGGQSWTSEWLKFDNSYFKEIKERRDEDLLVLPTDAVLFEDSSFKIHAEKYAEDQDAFFEDYAEAHAKLSNLGAKFDPPKGISLE*

Retrieve as FASTA  
Remarks Complete sequence from 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCGTGCACCGCATCCTCCGCCGCGGGCTCTCCGCCGCCTCTCCCCTCCCTTCTCTCCGCGGCCTCCTCCTCGTCTCCCCTCAGGTACCACCTATTCACGCTCCCCTCGGCGTC
CATTACCCGCGCCGGCGCACGGTTTCTTGATTTTTTTTATCGGTGATGTTTCTTTCGCTTTCCCCGCGAAGGAGCTCGGCAGGCGTCCGGCGAGCTCGTCGTCGTCGGCGGCGGCGGCTG
CGGGGGACGTGGAGGCTGAGCTGCGCGCCGCGCGGGAGGACGTCAGGCAGCTGCTCAAGTCCAACCCCTGCCATCCCATCCTG
GTACCCTGTACAAAAATTTTTAGATTATCTGTCTAGC
TGTCAAATTTTGCATCTGTAAACAAGTTCGTTATCACTGTGATATGTAGTGAACTAGTGCTAACAATATGGTCTATGTGATTGCGTGTTTAGTTAACTGGTAGATTATGCTGTTCGAACC
AATAATTTTAGACTTTGAGGGGATGACTGATGAGGAATAGCTATTTTTTTTTAGTATTCGCTATATTTGCGTGGTTCATGGTTGTGCATCTTCTTGATCAAACATGCATATTTATGACAT
GTCTGCTGAGTTACCATTGGTTTCAGGTTCGGTTAGGGTGGCATGACGCTGGCACTTACGATAAGAACATCACTGAATGGCCAAAGTGTGGTGGTGCGAATGGTAGCTTGAGATTTGGAG
TTGAGTTAGTACATGCAGCTAACAAAG
GTAGTGGCGCGTCTGGTCCATTAAGTATCAGTTGGTTCCTGATGCATATATGATGATTCTTACAGTAGTTCTCTGCTGCAGGTCTTCTGAAGG
CGTTATTCTTGGTCATTCCCATCAAGAGCAAGTATGCAGGTGTCACTTATGCAGATATATTTCAACTTGCCAGTGCTACAGCCATTGAG
GTCCTTCTGGCACTTCTAATCTAATCTAATG
ATATCTATCATTCAAATAGTTCTTCCTTATTTAGTGGTGATATGACTGCTTTGGCTTTCGCATTTCAGGAAGCCGGTGGCCCCAAGATCCCCATGATCTATGGAAGGGCTGATGTTGCTG
ATGGTGAAGAATGCCCACCTGAGGGGAGACTTCCTG
GTCAGTAACTTTTAGGTTCTGTAGACCAAATTTGTTCATAACCATGATTTGTCGTCTATAAACAAAACTATAATGCTGTCCCTT
TAGTGTCATGTCATACCGATCTCAAGTTACTATTGCAGTGGGTCATCATCTTACAACTTCATTTCCCAGATGCTACTTTCTTCTAATTCATTAAACTTAGAATATTGATATGTTCTAGAG
CATTGAAATTTAATTGATATGCGTTTCAAAACACAGAAATAAACTTACAAATTTACTCTATTTGTCCTCTCCTTTTATCTCAATTTACGAGTTACATGCAATGCAACTGAGATACCTGAT
TGATGTAATCCTTTTCAAGCTTGTACACCTCTCACTTTAAGGAACCACCCATATCAAAATCTTTATTTGTCTGTTGTATGTACTCACACCAAAGTATGTTAACGTAGTGTCAATAATAGA
GGACATAAATATAATTGTAAATTTTTTCTTGCTACTAACTCATTGTAGGTGGCCTGTTATTTTTAAACAGATAATGGTCTGCCTATAATAGGTTGTTGCATTCCTGGTAATGTTTCCCAG
GTCCAACTTATTTAGAAGGTTTAGGCAGGGTACCTTATTCATGTATCTGTGGATTTTAGTTTGTGAAATACCAAAATTGGTGTGAACAGACTAAAAAAAAAAGAAAGAAACAAGTTATGA
AATATTGCTACTGTGAGCTCTATAATCTGGTGTAATCACATTTTGGATACGCAAATGTGCAAGAAAAATTACTCCAGTTACAATTTAAGGAAAATTTAAAGCTGCCCATGCTGCGCAGAA
TAAAAATCAGGCATGTGATCGTGCTTTGCCTGTGAAACTGATGAAATATTGCTTCCCTAGTCTTGCTGCAATTTCAGCTGTTTGGTTTTTGTAATCACATGGCATTGATATATTTCCTGC
TCTGTCGTATACTGACGATGATCTAATCCTCTTTCCTTTTAATGTTGTTTCTGTTGGTACAATGTTGTTCCCTGCATTTTACATTTCCACCCTTTCAGCTGCTGACCCACCTTCACCTGC
TGAACACTTGCGAGAAGTATTCTACAGAATGGGCCTGAGTGACAAG
GTACTTGCAAACTGGTTGATTCAATATTCCAAACAACTTTTCTGGGGGGTTTGCATTGGCTAGTCTCATCTGTT
TCGCGATCTGCAGGAAATTGTTGCGTTGTCAGGAGCTCATACACTTGGTCGAGCTAGACCAGAGCGTAGTGGATGGGGTAAACCAGAAACAAAATACACTGTATGTAACTTACAGCAGTT
GGTATTGTTCTGATTTTAAGAACACCTTGTCCATTGATGCATTTTCGAGTATTGCATGCTATTTAGTTATTACTATTTTTAGATTAGCACACCTTCATGAAGTTCTTCTGATGGTGAATT
TGTTCTTCTGATGGTGAATTTGTTATCTGGCTAATTGATTATTTTTCTTGACTGGCAAAGGAAAATGGGCCTGGTGCTCCTGGAGGGCAATCTTGGACATCTGAGTGGCTCAAGTTTGAC
AACAGCTACTTCAAG
GTAGGATGCACAATTTTCTATATTAATACTAAGCATTATAGCAGTAATAGAACTTATGCAAGTCTGCATACATATTCAGGAAATCAAAGAACGCCGAGATGAGGA
TCTTCTAGTTCTCCCTACTGATGCTGTGCTCTTTGAGGACTCATCATTCAAG
GTTAGTGAAGTTGCTCATCAGCTAGTGTTGTAAAGAATTGCAAATCAAAAGTGATGCTCTAAATTTTT
TTCTTTTTTTGCTTGCTTGTCATGCCTGAAGATCCATGCTGAAAAGTATGCTGAGGATCAGGATGCATTTTTCGAAGACTATGCTGAAGCTCATGCCAAACTGAGCAATCTTGGGGCAAA
GTTTGATCCTCCAAAG
GTAAATGAGATTAAAGACTTCCTCACTTCCATTATTGGAATGGAGAAAATGTCCAGTCAACTTGACTTGCTTATTATCGCTGAAATGGCACAGGGTATTTCACT
TGAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCGTGCACCGCATCCTCCGCCGCGGGCTCTCCGCCGCCTCTCCCCTCCCTTCTCTCCGCGGCCTCCTCCTCGTCTCCCCTCAGGAGCTCGGCAGGCGTCCGGCGAGCTCGTCG
TCGTCGGCGGCGGCGGCTGCGGGGGACGTGGAGGCTGAGCTGCGCGCCGCGCGGGAGGACGTCAGGCAGCTGCTCAAGTCCAACCCCTGCCATCCCATCCTG
GTTCGGTTAGGGTGGCAT
GACGCTGGCACTTACGATAAGAACATCACTGAATGGCCAAAGTGTGGTGGTGCGAATGGTAGCTTGAGATTTGGAGTTGAGTTAGTACATGCAGCTAACAAAG
GTCTTCTGAAGGCGTTA
TTCTTGGTCATTCCCATCAAGAGCAAGTATGCAGGTGTCACTTATGCAGATATATTTCAACTTGCCAGTGCTACAGCCATTGAG
GAAGCCGGTGGCCCCAAGATCCCCATGATCTATGGA
AGGGCTGATGTTGCTGATGGTGAAGAATGCCCACCTGAGGGGAGACTTCCTG
CTGCTGACCCACCTTCACCTGCTGAACACTTGCGAGAAGTATTCTACAGAATGGGCCTGAGTGACAAG
GAAATTGTTGCGTTGTCAGGAGCTCATACACTTGGTCGAGCTAGACCAGAGCGTAGTGGATGGGGTAAACCAGAAACAAAATACACTGAAAATGGGCCTGGTGCTCCTGGAGGGCAATCT
TGGACATCTGAGTGGCTCAAGTTTGACAACAGCTACTTCAAG
GAAATCAAAGAACGCCGAGATGAGGATCTTCTAGTTCTCCCTACTGATGCTGTGCTCTTTGAGGACTCATCATTCAAG
ATCCATGCTGAAAAGTATGCTGAGGATCAGGATGCATTTTTCGAAGACTATGCTGAAGCTCATGCCAAACTGAGCAATCTTGGGGCAAAGTTTGATCCTCCAAAGGGTATTTCACTTGAA
TAG

Retrieve as FASTA