Entry information : OsAPx06
Entry ID 1870
Creation 2006-06-28 (Christophe Dunand)
Last sequence changes 2006-06-28
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette)
Peroxidase information: OsAPx06
Name OsAPx06
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Stromal
Tissue types Flowers
Leaves
Pannicles
Roots
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx06
start..stop
S start..stop
SiAPx06 573 0 4..309 3..311
HvAPx05 571 0 4..309 3..312
TaAPx03 565 0 4..309 3..313
SbAPx06 550 0 4..309 3..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3958687..3958752 66 N° 2 3958434..3958556 123 N° 3 3957967..3958087 121 N° 4 3957794..3957894 101
N° 5 3957604..3957691 88 N° 6 3956507..3956574 68 N° 7 3956339..3956425 87 N° 8 3955764..3955838 75
N° 9 3955600..3955677 78 N° 10 3955399..3955503 105 N° 11 3955300..3955317 18  
complement(join(3955300..3955317,3955399..3955503,3955600..3955677,3955764..3955 838,3956339..3956425,3956507..3956574,3957604..3957691,3957794..3957894,3957967. .3958087,3958434..3958556,3958687..3958752))


exon

Literature and cross-references OsAPx06
Literature Kikuchi,S. et al. (2003)
Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice. Science 301 (5631), 376-379.
Protein ref. UniProtKB:   Q2QWY2
DNA ref. GenBank:   NC_008405.1 (3958752..3955303)
Protein sequence: OsAPx06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   309
PWM (Da):   %s   33352.13  
PI (pH):   %s   7.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVVHRLLRRGLSAASPLPSLQELGRRPASSSAAAAGDAAAELRGAREDVKQLLKSTSCHPILVRLGWHDAGTYDKNITEWPKCGGANGSLRFEIELKHAANAGLVNALKLIQPIKDKHAGVTYADLFQLASATAIEAGGPKIPMIYGRVDVAAPEQCPPEGRLPAAGPPSPAEHLREVFYRMGLSDEIVALSGAHTLGRSRPERSGWGKPETKYTKNGPGAPGGQSWTSQWLKFDNSYFKDIKERRDEDLLVLPTDAVLFEDSSFKIYAEKYAADQDAFFEDYAEAHAKLSNLGAKFDPPKGISLE*

Retrieve as FASTA  
Remarks Complete sequence from 10 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCGTCCACCGCCTCCTCCGCCGCGGCCTCTCCGCCGCCTCTCCCCTCCCCTCTCTTCAGGTACTAGTACCACCTACGACGCCTCCCCCCCTCCCTTTCGCTGTTCATTACCCG
CGCCGGCGGCGGACCGGTTCTTGATTTAGCGATGTCCCTTTCTTGATGATTTTTGTTCATTTTCTCCCCCGTGAAGGAGCTCGGGAGGCGTCCGGCGAGCTCGTCGGCGGCGGCGGCGGG
GGACGCGGCGGCTGAGCTGCGGGGCGCGCGGGAGGACGTCAAGCAGCTGCTCAAGTCCACCTCCTGCCATCCCATCCTG
GTATGCTAATATATGCTTTGCTGCTTTAGTGTTCTTGTGCA
AAGATTGCGGGTTTGTATGGTTCGAAGAGTATAATGGGATTTTAGATTGTCTAGCTATATCCATGGATTTCGCATCTCTACAAAAGATTGTTCTTTGTGTGTTTAGTTAACTGGTCGATT
ATGCTATTTAAAACAGTAACTTTTACTTCGAGAAGATGCAACTGCTCTAGTTCACCTGTGTGCAAGAAGACTGTAACACGTTCTATGCACAATATTCGCTAGATTTGTGCAGTTCATGGT
TCTGCATCTGCTTGATCGAACATTGCATATTTATGACTTGTCTGCTGGGTTAACCTTGGTTGCAGGTTCGGTTAGGGTGGCATGATGCTGGTACTTATGACAAGAACATTACTGAATGGC
CAAAGTGTGGTGGTGCCAATGGTAGCTTGAGATTCGAAATTGAGTTAAAACATGCGGCTAATGCAG
GTAGTGCTTCTGTTCTGTCATTATCTATTGTTCGTGATTCATGGTTATCCTTAC
AATAACCCTCTACTTCAGGTCTTGTGAATGCTTTGAAGCTGATCCAGCCCATCAAAGACAAGCATGCAGGTGTCACTTATGCAGATCTGTTTCAGCTCGCCAGTGCTACAGCCATTGAGG
TCCTTTTGTCACTTTAGTCTAATGATAACTATGAACTATCATTCAAACAGTATTTATTATTTAATGCTGATATGATTGCTTTGGTCTGTTTTAAAACTCAGGAAGCCGGTGGCCCCAAGA
TCCCCATGATCTATGGAAGGGTTGATGTTGCTGCCCCTGAACAATGCCCGCCAGAGGGGAGACTTCCTG
GTCAGTAGCTTTTGGGTTCTGTAGCCCAAATTTGTTCGTTACCGTGATTTA
TCATCTGGAAACTAAAATATAATGCTGTACCTTTAGTGTCATGTCACACTGATCCCAAGTTGCTATTACAATTGGCCATCTTCTTGCAGCTTCATTTCGCAAATTCTACTTTCTCCTTAT
TCATTAAACCTAGAATATTGATAACTTTCAGAGCAGAACTGATATGTGTTCCAACACTCAGAAATGAAGTTACAAATATACTCTATTGGTCCTCTTGTTTAATCTCAATTTATGGGTTAT
CATGCAATTGAGATACCTGATTGACATAGGAAATCGCGCATATCCATCTTTATTTGTCTGCAATCTATTTACATCAAAATCAAATTATTTAGATGTAGTGTCAACAATAGAAGACATTAA
TATAAATTGATAGTTTTCTTGCTAACCTACTGTAATAGTCCTGTTTTATTTCTTCTTTAATGATAAATTTATTTTCTTAAATGGACAATGGTCTGCCTATAATAGGCTATTACATTCGTG
GTAATGCCTCTCAGATTCAACTTATTTAGAAGGTTTAGGCGTGGTATCTTATCCATGTATCTATGGGTTTTACTTCATGAAGTACTAAAATTGATGCTAACTGGCTAAAAGCATGAAAAA
ACAAGTTTCTTATGAAATATTGCCACCGTGAGCTCTGTAATCTGGTGTAATAACATTTTGGACATGCAAATGTGTAAGAAAGATTACCCCAATTGCAATATAACAGAAAAATTGTAAGCT
GCACATGCTGTGCAGAATGAAAATCAGTGCTATGATTGCACTTAACCTGTGAGATTGATAAAATATAGCTCCCCAAGAATTGCAGCACTTTCAGCTGTTTGTTTTTGTATTCACATGACA
TTGATATATTTCCTGCTGTGTCTTATAGTGTACTTTGATATTTGAAATCTAGTGCTGATGATGATCTAATCCTCTTTCATATGCATGTGCTTTCTGTTGCAATTTTGTTCCCTATATTTT
ACATTTCCACCCTTTCAGCTGCTGGCCCTCCTTCACCTGCGGAACATCTACGAGAAGTATTCTATAGAATGGGCCTGAGTGACAAGGTACTTGCAGATTGCTTCATTCAATATTCCAAAC
AACTTTTTCTGGGGATTTGCTAGTTACATCTGTTTTGTGATCTGTAGGAAATTGTTGCATTGTCAGGAGCTCATACACTTGGACGATCTAGACCAGAGCGCAGTGGATGGGGCAAACCAG
AAACTAAATACACT
GTATGTAACTTATATAGTTATATCAGTAGTAGGTTATTGTTCTGATTTTAGTAACGCCTTGTCCATGATTCATTTTGGAGTATTGCATGTTATTTAGTTACTACGT
ATTTTTTAGATTAGCCAATGGGATAATTAAGTTGTCATCACTGGCAATGCTTATTGATCTTGCATATATCTCTTCCTTGTAAAAGCTCTGTATTGAAGATCTTTATATGATTTATTACTA
CTTCACCGAAGAAAATAAAGAGATGCTTCTGCGCTGTTGTGTTAGTTGACCATATTATGCTTCATCTCTAATCGCGGATGACCTATATTAGCATCAATGCTACAAACTTTCCTACTACAG
TGCTTATATGCTTTCAAATATGTTCTTGTGGGTAGTAGACTTGCAGTATTAACTATATCTAGCATGCACTCCTTCATGAAGTTCTTGCTGATGAATGTTCTGAATGTTGAATTTCTTGTT
TGGCTAATTGATTAATTTCTTTTGACTCGCAAAGAAAAACGGACCTGGTGCACCTGGAGGGCAATCTTGGACATCACAGTGGCTGAAGTTTGATAATAGCTACTTCAAGGTAGGATGCAC
TATTTTCTTTATCAATACCAAACATGATAGCAGTTACAATTTACAAAACTTATGTTAGTCTGCATAAAATTTAAGGACATCAAAGAACGCCGAGATGAGGACCTTCTAGTTCTGCCTACT
GATGCTGTGCTCTTTGAGGACTCATCATTCAAG
GTTAGTGAAGATTCTCATCAGCTCTTGTTGTAAAGAACTGCAAATCAAAAGTGACGCTCTAAACTAAAAAGTTTTGCTTGCTTGCCA
TGCCTGAAGATCTATGCTGAAAAGTACGCCGCAGATCAGGATGCATTTTTTGAAGACTATGCTGAAGCTCATGCCAAACTGAGCAATCTCGGAGCAAAGTTTGATCCTCCAAAGGTAAGT
GAGATTAAAGACTAACATTACTGGAATTAAAAAATGTGCAGTCAACTTGACATGGTTATCACTGAAATGACACAGGGTATTTCACTGGAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCGTCCACCGCCTCCTCCGCCGCGGCCTCTCCGCCGCCTCTCCCCTCCCCTCTCTTCAGGAGCTCGGGAGGCGTCCGGCGAGCTCGTCGGCGGCGGCGGCGGGGGACGCGGCG
GCTGAGCTGCGGGGCGCGCGGGAGGACGTCAAGCAGCTGCTCAAGTCCACCTCCTGCCATCCCATCCTG
GTTCGGTTAGGGTGGCATGATGCTGGTACTTATGACAAGAACATTACTGAA
TGGCCAAAGTGTGGTGGTGCCAATGGTAGCTTGAGATTCGAAATTGAGTTAAAACATGCGGCTAATGCAG
GTCTTGTGAATGCTTTGAAGCTGATCCAGCCCATCAAAGACAAGCATGCA
GGTGTCACTTATGCAGATCTGTTTCAGCTCGCCAGTGCTACAGCCATTGAG
GAAGCCGGTGGCCCCAAGATCCCCATGATCTATGGAAGGGTTGATGTTGCTGCCCCTGAACAATGCCCG
CCAGAGGGGAGACTTCCTG
CTGCTGGCCCTCCTTCACCTGCGGAACATCTACGAGAAGTATTCTATAGAATGGGCCTGAGTGACAAGGAAATTGTTGCATTGTCAGGAGCTCATACACTT
GGACGATCTAGACCAGAGCGCAGTGGATGGGGCAAACCAGAAACTAAATACACT
AAAAACGGACCTGGTGCACCTGGAGGGCAATCTTGGACATCACAGTGGCTGAAGTTTGATAATAGC
TACTTCAAG
GACATCAAAGAACGCCGAGATGAGGACCTTCTAGTTCTGCCTACTGATGCTGTGCTCTTTGAGGACTCATCATTCAAGATCTATGCTGAAAAGTACGCCGCAGATCAGGAT
GCATTTTTTGAAGACTATGCTGAAGCTCATGCCAAACTGAGCAATCTCGGAGCAAAGTTTGATCCTCCAAAG
GGTATTTCACTGGAATAA

Retrieve as FASTA