Entry information : OsAPx07
Entry ID 1871
Creation 2005-07-12 (Christophe Dunand)
Last sequence changes 2010-08-03 (Marie Brette (Scipio))
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsAPx07
Name OsAPx07
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Stromal
Tissue types Callus
Leaves
Pannicles
Radicles
Roots
Spikes
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx07
start..stop
S start..stop
BdiAPx07 558 0 47..358 47..344
TaAPx02 556 0 47..358 47..347
HvAPx06 555 0 47..358 47..347
SiAPx05 535 0 42..358 33..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21635351..21635527 177 N° 2 21635088..21635246 159 N° 3 21633870..21633990 121 N° 4 21633684..21633784 101
N° 5 21633478..21633565 88 N° 6 21633091..21633158 68 N° 7 21632908..21632994 87 N° 8 21632337..21632411 75
N° 9 21632171..21632248 78 N° 10 21631939..21632043 105 N° 11 21631718..21631738 21  
complement(join(21631718..21631738,21631939..21632043,21632171..21632248,2163233 7..21632411,21632908..21632994,21633091..21633158,21633478..21633565,21633684..2 1633784,21633870..21633990,21635088..21635246,21635351..21635527))


exon

Literature and cross-references OsAPx07
Literature Kikuchi,S. et al. (2003) Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice. Science, 301 (5631), 376-379.
Protein ref. UniProtKB:   Q7XJ02
DNA ref. GenBank:   NC_008397.1 (21635527..21631721)
Protein sequence: OsAPx07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359
PWM (Da):   %s   38244.53  
PI (pH):   %s   9.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAQRLAALHAAAPSAFSSTSSASHGRPAARSSTTALLPVALPRASATLRAAPSRLLPQEAKAAGSGRSVMCMASASASAASAAVASGAAELKAAREDIRELLKTTHCHPILVRLGWHDSGTYDKNIKEWPQRGGANGSLRFDVELKHGANAGLVNALKLVQPIKDKYPNISYADLFQLASATAIEAGGPKIPMTYGRIDVTGPEQCPPEGKLPDAGPSAPADHLRKVFYRMGLDDEIVVLSGAHTLGRSRPERSGWGKPETKYTKNGPGAPGGQSWTAEWLKFDNSYFKEIKEKRDQDLLVLPTDAALFEDPTFKVYAEKYAEDQEAFFKDYAGAHAKLSNLGAKFNPPEGFTLDG*

Retrieve as FASTA  
Remarks Complete sequence from 7 (TC251329) and 12 ESTs (TC251330).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCCAGCGACTCGCCGCCCTCCACGCCGCCGCGCCGTCGGCCTTCTCCTCCACCTCCTCCGCCTCGCATGGCCGCCCCGCGGCGCGATCCAGCACCACCGCTCTCCTCCCGGTG
GCCCTCCCGCGCGCCTCCGCCACCCTCCGCGCCGCACCTTCTCGGCTCCTCCCCCAG
GTCCGTGTCGGCTCGGTCTTGGGTGGTGGTTGGGTTGGGGTTTGGGACGCCCTGGTTGTTTGT
TGTTGTTGACTCGTGCTCTGGCTGTGTGTGTGTGATCGCAGGAGGCGAAGGCGGCGGGGAGCGGCAGGTCGGTGATGTGCATGGCGTCGGCGTCGGCGTCGGCGGCGTCGGCGGCGGTGG
CGTCGGGCGCGGCGGAGCTGAAGGCCGCTCGCGAGGACATCAGGGAGCTCCTCAAGACGACGCACTGCCACCCCATCCTG
GTATGATCTCGTCTCGTGTACACGCACCACGCGATGCGGC
TTTGGTTGCTCCGAAACTTCTCCTTCATATCAGCATCACCATGTGGGAGATTTGATTCGGTAGCAGAGGAGCCATCTGGCCGATCGCCTTTGCAACCAAGGATTGCACATGAGAACAAAC
TCAGCTCGGAGACAGCGATGTTATGAGTTTGTGAACACACTGAATTTTCTCTCTGGAGACAGTGATGTCATGAATCTGTGAACACACTGAATATGCTCTCTGGAGCAATGCTGGAATTTA
ACATCACGAGGAAGTAATTTCATGACCAGCTTGCCTCTCAAATAGGATTTTGACCTCTAGAAATAGCGTATTGTCGTAAATCACCAATGTGTAACGACAGTTCAATTGTTAAGTCTGATC
TCATCTGTACTGACGAGTAGGTTGCACATGTCACAAATGGCTTGTGAGAGTTAAGAGTTGTATTGAAAGTTTGAAACTATAAATTCATTCATCACGTATCCTATCATCATTTATTGTTTG
TGGTGATAACTGATACTAACACTTGCAGCAGCTTTTCCCAGTGAGACTATCAAGTATCATGTGAGTTACTCTGTCCGTTCTCAAATATAAGTATTTCTAGCCAGAAATGCTTACATTTAG
GAACGTAGGTCGTGCTTGTGTAAATTGTTAGGCTGTGTTCAATTAGTTATCAGATGGTACAAGTAAATTCTAAGGAATTAGGCAATATGAATGCGGCGTTGAATAATTAATGACAGCAGA
ACAACATTATCATAGCACTAGGACATAAGTCCAGTTCATTGGTTATTTCCATGCTATTTTACCTTCATATGGTCATGGCTATGATATGCCAGCTTGCTGAAGTTAAAGGTGTTAATAGGG
CTGCCATTTATCCAAATAATCACCATTGACTGAACTTGTACTGTCGTACATTTTGAATTTGCAAATACTGAATGCAATGCAACGGGGGTAGACCACGGCACCATTTCCTATTGTTTAGTT
CCATTCAAACCCTTGCATGTGCACAATCAATTGGCTTTCTACTCCAGTTTCTCTATATCCACGGTGGTTAAAATGTTATTCCTTTGCCTGCATGAAGGTTCGTCTTGGATGGCATGATTC
CGGTACGTATGACAAGAATATTAAAGAGTGGCCACAACGAGGTGGAGCTAATGGAAGCTTGAGATTTGATGTTGAGTTAAAACATGGAGCCAATGCTG
GTAACATTACCTTTTCACGATT
TCGTTTCCTTGTTGCTTGTAAGTGTACTTTCAGCAACTAAAAATCCTGATTGAATTATTGAAGGGCTGGTAAATGCTCTAAAGCTTGTCCAACCTATCAAGGACAAATACCCAAATATCT
CATATGCGGATTTATTCCAGCTGGCAAGTGCTACAGCAATTGAG
GTCTGATCCCCTCACGCCCCCAAAAAATAATGAAAAATGAAGTACCTAACTAGTCTGGTTTTAATGTACGAACACT
ATATTCTACCTTAATGATCCATTTTTGTCAAACTTGTACTAGGAAGCTGGTGGTCCAAAGATTCCAATGACATATGGACGGATTGATGTCACAGGTCCTGAGCAGTGTCCACCTGAGGGG
AAGCTTCCCG
GTTAGCAACTTATGTTTCACTGGATTTTCCAAAACACTAACATCTGTACTGATATCCTGTCTTGCTTACTTCATAATTGTTCTTTTTAATTTTTAAATGTAAAGGTTCCT
ATGTACATTGTCTCTCATCAGCTTAATATATCAACCGACCTTATTTTTTCCCTTGGAAAATTATGGGATAGTTTTTATTGCCACGCTAACAGGCATAAAACTGTTCTTACATATAGGGGT
ATTTAGGAAATATTGCACCAGCATCATACTCAATCCCTTAAAACTGATGCTTGCTAACTTTCAGTTATCCTTCCCTTTTGGTTGCTCAGATGCTGGCCCAAGTGCACCTGCGGATCACTT
GAGGAAGGTATTTTACAGGATGGGTCTTGATGACAAG
GTGTGCAAATGAGATTCTAGTTAACCAGATGTTTTCCCATTTGCTTTGTTTTATGTGATGTTGAGTTGCATGTGCCCCGCGAT
GCTGTGCCTACAGGAGATTGTTGTGCTGTCTGGAGCACATACACTTGGAAGGTCCAGACCTGAACGGAGTGGCTGGGGGAAACCAGAAACGAAATATACTGTATGTTCTTCTTATCTTTA
TTTTCTTATGTGAGAACCGAGTTTTGAGCATGATCTCAGTTCTATCCACTGTTTCAATGTATTCCCATGTTAAGTCTATCATTGCATATCATGTCATCATTTTTGCAACAAGGAGTCAAG
GACCACTTAGTACTTCATGATGTTTTATGCTTTCAGTACTTAATGTCTCTGCTTAAATTACCCTTATTCCTCAGGAAAGAAACTACGTGTATTAATTTCAAGATGTGTACATAGCTACAG
ACTAGAGTAAATCAGAACTCCATACGTTTTAGATATTTTTCCTTGGCCTCTGCTCCGATGGTTTTGGCTGAAGGATGTACTTTTTGCTCACATAATCTCTATATATTCTCTGCAAAATAT
CGTGCCGCCTCTGCAACTCCATGAAGCAACATCAACTCCAAGTGCATTTGTCTTTATGGTTAGACTGGATTGGACAAATCTTGAGCTTTTTCACCTTTTTTTTCTTACTTTTTCAGAAGA
ATGGCCCTGGTGCACCTGGTGGGCAATCGTGGACAGCTGAATGGCTTAAGTTTGATAACAGTTATTTCAAG
GTACGTGCCACTTTTCCCTTATTCTTCATGTCGGATGATTCATATGATT
TTGCATGATGTGAGCTGGTGCCTGGTGGCAATACTGCAGGAGATAAAAGAGAAAAGAGATCAGGATCTCCTGGTCTTGCCTACAGATGCTGCATTATTTGAGGACCCAACATTCAAGGTG
AATAATGCTTAAACTGTACTCTCACTTCCCGAAATAAACCAATCTCGTACTAGGATATGTCAGGATCATTTGAAAATTGAAATAATTATTGAACTAACTGTCTGAGAATTCACCGCACAT
TCAGGTCTATGCAGAAAAATACGCAGAGGACCAAGAAGCATTCTTTAAAGACTATGCCGGAGCTCATGCTAAACTGAGCAATCTGGGTGCAAAATTCAATCCTCCTGAGGTGAGTGATAA
CATCTTGTCCTTAGTTTTCCTTTCCACAACACGCCACTCTTGACCGACTGGGCCACAGTTAGTAGAGATAGTTTATCCGACAAACCACTGCCAAGTTGTTTTTACCCCCGATGACTAGCG
CCCAATCCTAGTCCGTGGTCCTTCTGTTGTGGCAAACTGAGAGTATGTGACTGTTTGGTTGTCCTGCAGGGATTCACGTTGGACGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCCAGCGACTCGCCGCCCTCCACGCCGCCGCGCCGTCGGCCTTCTCCTCCACCTCCTCCGCCTCGCATGGCCGCCCCGCGGCGCGATCCAGCACCACCGCTCTCCTCCCGGTG
GCCCTCCCGCGCGCCTCCGCCACCCTCCGCGCCGCACCTTCTCGGCTCCTCCCCCAG
GAGGCGAAGGCGGCGGGGAGCGGCAGGTCGGTGATGTGCATGGCGTCGGCGTCGGCGTCGGCG
GCGTCGGCGGCGGTGGCGTCGGGCGCGGCGGAGCTGAAGGCCGCTCGCGAGGACATCAGGGAGCTCCTCAAGACGACGCACTGCCACCCCATCCTG
GTTCGTCTTGGATGGCATGATTCC
GGTACGTATGACAAGAATATTAAAGAGTGGCCACAACGAGGTGGAGCTAATGGAAGCTTGAGATTTGATGTTGAGTTAAAACATGGAGCCAATGCTG
GGCTGGTAAATGCTCTAAAGCTT
GTCCAACCTATCAAGGACAAATACCCAAATATCTCATATGCGGATTTATTCCAGCTGGCAAGTGCTACAGCAATTGAG
GAAGCTGGTGGTCCAAAGATTCCAATGACATATGGACGGATT
GATGTCACAGGTCCTGAGCAGTGTCCACCTGAGGGGAAGCTTCCCG
ATGCTGGCCCAAGTGCACCTGCGGATCACTTGAGGAAGGTATTTTACAGGATGGGTCTTGATGACAAGGAGATT
GTTGTGCTGTCTGGAGCACATACACTTGGAAGGTCCAGACCTGAACGGAGTGGCTGGGGGAAACCAGAAACGAAATATACT
AAGAATGGCCCTGGTGCACCTGGTGGGCAATCGTGGACA
GCTGAATGGCTTAAGTTTGATAACAGTTATTTCAAG
GAGATAAAAGAGAAAAGAGATCAGGATCTCCTGGTCTTGCCTACAGATGCTGCATTATTTGAGGACCCAACATTCAAGGTCTAT
GCAGAAAAATACGCAGAGGACCAAGAAGCATTCTTTAAAGACTATGCCGGAGCTCATGCTAAACTGAGCAATCTGGGTGCAAAATTCAATCCTCCTGAG
GGATTCACGTTGGACGGTTAA

Retrieve as FASTA