Entry information : OsAPx08
Entry ID 1872
Creation 2005-07-12 (Christophe Dunand)
Last sequence changes 2005-07-12
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsAPx08
Name OsAPx08
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Thylakoid-bound
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx08
start..stop
S start..stop
TaAPx01_C306 733 0 1..478 1..443
ZmAPx08 713 0 1..478 1..451
SbAPx08 708 0 1..478 1..454
BdiAPx04 694 0 1..478 1..440
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20891271..20891441 171 N° 2 20891008..20891169 162 N° 3 20890793..20890913 121 N° 4 20890583..20890683 101
N° 5 20890396..20890483 88 N° 6 20890216..20890283 68 N° 7 20890037..20890123 87 N° 8 20889308..20889382 75
N° 9 20889148..20889225 78 N° 10 20888969..20889073 105 N° 11 20888242..20888469 228 N° 12 20888010..20888162 153
complement(join(20888010..20888162,20888242..20888469,20888969..20889073,2088914 8..20889225,20889308..20889382,20890037..20890123,20890216..20890283,20890396..2 0890483,20890583..20890683,20890793..20890913,20891008..20891169,20891271..20891 441))


exon

Literature and cross-references OsAPx08
Literature Morita,S., Kotani,T., Kaminaka,H., Masumura,T. and Tanaka,K. (2003) The expression of rice chloroplastic ascorbate peroxidase genes during greening. NCBI Direct Submission.
Protein ref. UniProtKB:   Q69SV0
DNA ref. GenBank:   NC_008395.1 (20891441..20888013)
Protein sequence: OsAPx08
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   478
PWM (Da):   %s   51068.72 Transmb domain:   %s   o458-477i
PI (pH):   %s   5.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERIAASLLPAASPSPAPSPPPPRPRVSAAAAASFPCCSTSAGGLRLRSRPSRFPQKAATTRSGRAGAGARAVVRCMAAAAVAASDAAQLKSAREDIREILKTTYCHPIMVRLGWHDSGTYDKNIEEWPQRGGADGSLRFDAELSHGANAGLINALKLIQPIKDKYPGITYADLFQLASATAIEAGGPKIPMKYGRVDVTAAEQCPPEGRLPDAGPRVPADHLREVFYRMGLDDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGEPGGQSWTVEWLKFDNSYFKDIKEQRDQDLLVLPTDAALFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSDLGAKFDPPEGFSLDDEPAVEEKDPEPAPAPAAAPPPPPVEEKKEAEPTPVPVTVGAAVASSPADDNNGAAPQPEPFVAAKYSYGKKELSDSMKQKIRAEYEGFGGSPDKPLQSNYFLNIMLLIGGLAFLTSLLGS*

Retrieve as FASTA  
Remarks Complete sequence from 17 (TC263934) and 3 ESTs (TC263935)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCATCGCCGCCTCCCTCCTCCCGGCTGCCTCGCCCTCGCCTGCTCCGTCCCCTCCCCCCCCGCGCCCCCGCGTCTCCGCCGCGGCCGCCGCCTCCTTCCCATGCTGCTCC
ACCAGCGCCGGCGGCCTCCGCCTCCGCTCCCGCCCGTCTCGCTTCCCGCAG
GTTCGCAATAGTTTTAGCTCGGCTCGTGTTTTTTTTTTTTTGGGGGTGGGGGGGGGGTTGAATCGAGGT
GTTCTGAGTTGACTGATGCGTGGCACCTGCAGAAGGCTGCGACGACGAGGAGCGGGCGCGCCGGCGCGGGGGCGCGGGCGGTGGTCCGGTGCATGGCGGCGGCGGCGGTGGCGGCGTCCG
ACGCGGCGCAGCTCAAGAGCGCCCGGGAGGACATCAGGGAGATCCTCAAGACCACCTACTGCCACCCCATCATG
GTACGGAACGCCCGCGCCATCTCAGCTCTCGCATCCATATGAACAG
AGAAGAGTCAGAGATGATGAAATCCTGCGATCCTGCTACCATGTACAGGTCCGTCTTGGGTGGCACGATTCTGGCACGTACGACAAGAACATCGAGGAGTGGCCGCAGAGGGGCGGAGCC
GACGGGAGCTTGAGATTTGACGCCGAATTGAGCCACGGAGCCAATGCTG
GTACTTAATTTCTCGTGTCTCGGCAGTGCAATTTCGAATTCAGGAAATTCGTGGAGTAATCGTGCTGATTT
CCTTCATAATCGTATGGTTTTGGTTGGAATTTTGATAGGTCTGATTAATGCTTTGAAGCTTATCCAACCAATCAAGGACAAATACCCGGGTATAACTTATGCTGATTTGTTCCAGTTGGC
AAGTGCTACAGCAATTGAG
GTCTCAGACTTCTTCTCTCTGCTCTAGTGACTTTGCTAGATATTTTTTGGATGATCGGTAGTCTATGTGCTTGAATCTTTTGAGAAAAATTTCTTGCAGGA
AGCTGGTGGGCCGAAAATTCCAATGAAATATGGACGAGTTGATGTCACAGCAGCTGAGCAGTGCCCACCAGAGGGGAGGCTTCCTG
GTCAGTGTTTCCATTAAGTTCTTCATTCTGTTTC
TGATCAACGTTTGCATTTATGAATTGTGAGAGGAACTTATCAAAGAGTGACCTTCTGGTGTTGATAAATGCCCCCCAGATGCCGGTCCACGTGTGCCCGCTGATCATCTTAGGGAGGTAT
TCTACAGGATGGGCCTTGATGACAAG
GTGTGGATGATGCAAAAAAGAAATTAGTTGCCTATCTGCTATTTGTTCTTCATGTATGTTGTATAACCATTTCTTTTGGACTATTTATGCAGGA
AATTGTTGCATTATCTGGAGCACACACACTTGGAAGATCAAGACCTGACAGGAGTGGCTGGGGAAAGCCAGAAACAAAATATACT
GTATGTTTTCTTGTCCACTTTGGAAACTCAACAGG
AAAAATAAGTTATTTTCAGCAGTAGGAAGTTCTAGGCATGGCCAGACCTTCAATGTTCTACACTCTGGGTATAGAATATTACATTTTTGGGGCATTTGCAAATTTGCCACCGGTTTTTTC
AATATTGCAAGGATGCTACTCGAATGACAGTTCTAGTGATATTTTTGCAATTTTCTAGTGGCAGTTTTGCAATAACGATTCAAAGTAGTGGTAAATTTGCAATTGCCCCTACATTTTTTG
AGACATTCAGGCAGAGGTGAAAACAATGCATGTACTTTTTTGTGTTATCTTGTAAGTAAGCACCATATTATGCTTTTAAAATCCGTGAATACTTTGTCCTTATGCTGTAAATAAATAATG
TTTTAATTCAGGATTTTACAAAATGGGTTATCCTTACGTTTCTTTTGTATGCATATAATGGTAAAATAGAATTAGGATGCTAAGAACTTCATAGCTAACAACTTTGTCATTCTCTAAGCC
CTGATACTTCTCTGTGGGGAAATGAAGATTAACTTTTCGATGCAATCTTACCTTAATCACACCAGCACAATAGCAAATCAGATTAGTTTCAGTTTTCAGACTGACATTTAAAGGTGGCTT
CTATTATTGTGGTCTACAGAAGGATGGGCCTGGTGAACCTGGAGGGCAATCATGGACAGTTGAATGGTTGAAGTTTGATAACAGTTACTTCAAGGTGTGTTAGCATTTTGTCATGGTTTA
CAAAATTATTTTTTTCATTTGAATATGTGATGATTCAGCTGATGATAATGTTTCAGGACATAAAAGAGCAAAGGGACCAGGATCTTCTAGTGCTACCCACAGATGCTGCATTATTTGAGG
ATCCGTCCTTCAAG
GTTATTTGGTTGTGCTCAATTTGTGGCTTGAATAGCTCATAGGTCACTGTCTGAAATATCTGCAACATATGCAGGTATATGCCGAAAAATATGCAGAGGATCAGGA
GGCATTCTTTAAAGACTACGCTGAAGCTCATGCTAAACTGAGCGACCTTGGTGCAAAGTTCGATCCACCTGAG
GTGAGGACTACCATCTTTTTTTTTCATTTTGATCTCCTGGCAACCAA
TTGTGCCTAAACAATCATAAACAATACGAAAGACACTTAAGCTCTTAAGTTCTTTTATTAGAACATGCCAGATTTTCTTCCTCTTGTTTGCAAGTTCAAAACATGACTCCCTGATTCCTC
GTCCACATCGAGTAGATATCTTTTGTAATGTATTTTTTTTCTAGAGAATTCAGTAATGTACTTATGTGACAGTAAGATGGAGTACTGGACCTTCAGGACAGAAATATAGTTCAGATAGTT
TTTCTTTTTACCGAATGTAATCCAAACACTGGGAGTTTGAGGTAGTCCATCATATCAATCTTTCTTCTGCAATGCAACGAAATGGGGTTTACTATGGCAGCTTTTCTTAGCTGTTCTTCA
TGTAAAAACCAGTGCAATTGTAGGTTGGATATTTACAGAGTCCAACTTTACCAGCCTTCGATCAGGAAGTGATGGATGTGATTTTCCTGCAGGGATTTTCACTGGACGATGAACCAGCCG
TCGAAGAGAAGGATCCTGAACCAGCACCAGCGCCAGCAGCAGCACCACCACCTCCACCAGTCGAGGAGAAGAAGGAAGCTGAACCAACTCCAGTACCAGTAACGGTAGGAGCAGCAGTGG
CATCATCGCCAGCGGATGACAACAACGGTGCAGCACCGCAACCAGAGCCCTTCGTCGCTGCGAAATACTCCTACGGAAAG
GTATGCACTCTCCACGAAGCCTAGCTTCTAGCCCTAGATT
TGATGGACAATGCATGGTATCTTGCAATGGCTTTTGCAGAAGGAGCTGTCGGACTCGATGAAGCAGAAGATCAGGGCGGAGTACGAGGGATTCGGAGGCAGCCCGGACAAGCCTCTGCAG
TCCAACTACTTCCTCAACATCATGCTCTTGATCGGAGGGCTGGCCTTCTTGACGTCTCTGCTCGGGAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCATCGCCGCCTCCCTCCTCCCGGCTGCCTCGCCCTCGCCTGCTCCGTCCCCTCCCCCCCCGCGCCCCCGCGTCTCCGCCGCGGCCGCCGCCTCCTTCCCATGCTGCTCC
ACCAGCGCCGGCGGCCTCCGCCTCCGCTCCCGCCCGTCTCGCTTCCCGCAG
AAGGCTGCGACGACGAGGAGCGGGCGCGCCGGCGCGGGGGCGCGGGCGGTGGTCCGGTGCATGGCGGCG
GCGGCGGTGGCGGCGTCCGACGCGGCGCAGCTCAAGAGCGCCCGGGAGGACATCAGGGAGATCCTCAAGACCACCTACTGCCACCCCATCATG
GTCCGTCTTGGGTGGCACGATTCTGGC
ACGTACGACAAGAACATCGAGGAGTGGCCGCAGAGGGGCGGAGCCGACGGGAGCTTGAGATTTGACGCCGAATTGAGCCACGGAGCCAATGCTG
GTCTGATTAATGCTTTGAAGCTTATC
CAACCAATCAAGGACAAATACCCGGGTATAACTTATGCTGATTTGTTCCAGTTGGCAAGTGCTACAGCAATTGAG
GAAGCTGGTGGGCCGAAAATTCCAATGAAATATGGACGAGTTGAT
GTCACAGCAGCTGAGCAGTGCCCACCAGAGGGGAGGCTTCCTG
ATGCCGGTCCACGTGTGCCCGCTGATCATCTTAGGGAGGTATTCTACAGGATGGGCCTTGATGACAAGGAAATTGTT
GCATTATCTGGAGCACACACACTTGGAAGATCAAGACCTGACAGGAGTGGCTGGGGAAAGCCAGAAACAAAATATACT
AAGGATGGGCCTGGTGAACCTGGAGGGCAATCATGGACAGTT
GAATGGTTGAAGTTTGATAACAGTTACTTCAAG
GACATAAAAGAGCAAAGGGACCAGGATCTTCTAGTGCTACCCACAGATGCTGCATTATTTGAGGATCCGTCCTTCAAGGTATATGCC
GAAAAATATGCAGAGGATCAGGAGGCATTCTTTAAAGACTACGCTGAAGCTCATGCTAAACTGAGCGACCTTGGTGCAAAGTTCGATCCACCTGAG
GGATTTTCACTGGACGATGAACCA
GCCGTCGAAGAGAAGGATCCTGAACCAGCACCAGCGCCAGCAGCAGCACCACCACCTCCACCAGTCGAGGAGAAGAAGGAAGCTGAACCAACTCCAGTACCAGTAACGGTAGGAGCAGCA
GTGGCATCATCGCCAGCGGATGACAACAACGGTGCAGCACCGCAACCAGAGCCCTTCGTCGCTGCGAAATACTCCTACGGAAAG
AAGGAGCTGTCGGACTCGATGAAGCAGAAGATCAGG
GCGGAGTACGAGGGATTCGGAGGCAGCCCGGACAAGCCTCTGCAGTCCAACTACTTCCTCAACATCATGCTCTTGATCGGAGGGCTGGCCTTCTTGACGTCTCTGCTCGGGAGCTGA

Retrieve as FASTA