Entry information : HaPrx22 (HanXRQChr10g029599)
Entry ID 1878
Creation 2005-09-27 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx22 (HanXRQChr10g029599)
Name (synonym) HaPrx22 (HanXRQChr10g029599)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx22
start..stop
S start..stop
HarPrx05 644 0 1..320 1..320
HaPrx20 495 1e-178 22..320 32..330
HaPrx21 492 2e-176 22..320 78..376
HaPrx[P]47 488 1e-175 16..320 22..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117155203..117155583 381 N° 2 117154967..117155129 163 N° 3 117152901..117153319 419  
complement(join(117152901..117153319,117154967..117155129,117155203..117155583))


exon

Literature and cross-references HaPrx22 (HanXRQChr10g029599)
Literature Kozik,A., Michelmore,R.W., Knapp,S., Matvienko,M., Rieseberg,L.,Lin,H., van Damme,M., Lavelle,D., Chevalier,P., Ziegle,J., Ellison,P., Kolkman,J., Slabaugh,M.S., Livingston,K., Zhou,Y., Lai,Z., Church,S., Jackson,L. and Bradford,K. Lettuce and Sunflower ESTs from the Compositae Genome Project
DNA ref. HanXRQ genome:   HanXRQChr10 (117155583..117152901)
EST ref. GenBank:   BQ915313 [Fragment]
Cluster/Prediction ref. HanXRQ:   HanXRQChr10g0295991
Protein sequence: HaPrx22 (HanXRQChr10g029599)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (300)
PWM (Da):   %s   34209.51 (32026.4)  
PI (pH):   %s   8.32 (8.20) Peptide Signal:   %s   cut: 21 range:21-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVYTLMCLLLATLATMTQGQTRVGFYSTTCPRVETIVRNAVQTAVRADPTLAAGVLRIFFHDCFVNGCDGSVLLDGPSSEKTAPPNVPLRGFEVIDAAKSQLETACPGVVSCADIAALAARDAVVLAGGTSWQVPLGRRDGLVSQASDTVNLPGFNDPISVQIRKFADKNLNIQDLVTLVGGHTIGTGACVVFSYRLYNFNNTNQPDPDINPAFLPQLRALCPNGGDGSRRVALDTGSVTRFDNSFYANLRNGRGVLESDAKLWSDPTTRPIVQRFLGLSGLLGLTFNVEFGRSMVKMGNIELKTGSQGEIRRVCRATN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTTTATACCTTGATGTGTCTTCTATTAGCCACCCTGGCCACCATGACACAAGGCCAGACAAGGGTTGGGTTTTATAGCACCACATGTCCAAGGGTTGAAACCATAGTACGAAAT
GCGGTTCAGACTGCTGTTCGAGCCGACCCCACACTTGCAGCTGGTGTACTAAGAATATTCTTCCATGACTGCTTTGTCAATGGTTGTGATGGGTCCGTACTACTTGACGGGCCATCAAGT
GAAAAGACCGCACCACCCAACGTCCCCTTGAGAGGATTCGAGGTTATCGATGCTGCAAAATCTCAGCTCGAAACCGCCTGCCCTGGAGTGGTCTCTTGTGCTGATATTGCTGCCCTTGCT
GCCCGTGACGCGGTGGTCCTG
GTTAGTATATCTTTTTGTAACATGATGTTTGTGTGTTATGAAGTTATCTAATTGCTTTAACTATGTTGTGCAGGCTGGTGGAACTAGTTGGCAAGTGCC
ATTAGGACGTAGAGATGGATTGGTTTCACAAGCATCTGATACTGTAAACTTACCTGGCTTTAATGATCCTATTAGTGTCCAAATCAGAAAGTTTGCTGATAAAAATCTTAACATCCAAGA
TCTTGTTACTCTTGTTG
GTAAGTACTAGGTAGCTACCTAGAGCACAAAATATATAAAAAAAAAAACTATATAATTTGTTTTTTTTTCTAAACTATGGAAATCTATATATGATAAAAATCA
AAAGGAATGAACAGTTATTTTATTTATTTTTTATACAGTGGTTTATTAATCAAAAGGAATGAATTGTTATTTTTATTTATTTTTTATACAGTGATTTATTATTTATTTTTTAAATTTAAA
TTACAGTAATTTATTATTTATTTTTTAAATTTAAATTAAAATTTAAATTAAAATTTAAATTAAAATTATAATGGAATGAATAGTAACATCATTAAGAGATGAGTAAATGGTATCGGGTAT
AGGTACCGTTCTCAAATTTACCAAATCGGTGTATTTTCGGTACCGGTTCTGCACAGGTATTCACCGGTTTTTACCCTCAAATACTGGTGCCGTACCAGTACCGACCGGTACCGAACCGTA
CCATACTAGGTATATTCGGTACCGGTACCCACTTTTGGGGATTTCGGTAACGGTATTTTCGGTACCGGTTGGTACCGAGCTCATCAAATCCTGTAGCAATGCAGAAATGCAAGTAATTGC
ACCGTTTAGATTACTTGTGATACACACAGTAAGTAAATTGTATTTCGTTTGAATGAGGTTTTATATACACAACAACTTATTTTGCTTTCTTTTTTGTCTTTTTCTGCAATGAATGAATTG
TAGTATGTAAAATTAATTTGGATATTTAGAATATTGATGAGCAAATCGTATCAAATTCTCTAAACGAACCGGTATCGTATCGGTACCAAATTTACTATACCAAATCATTTTCGGTACTAA
TTTGGTACCCACCTTTTTGGCGTTTTCAGAATCGTTACTTTCGGTTCGACACTGGTATAGCACCATACCTGTATTTATTGATTTTTACCTTCAAATACCATACCGTATTGTACCGAGCAT
TTTCGGTGCCGGTACCTAATTTTGATGATTTTCCGGATCGGTACTTTCTCTGCCGTTACCGGTAACGAGCTCATCCATATTTTAACGTGTTAGCATCGTAATAACTGAACTGAAAACAAC
CGAATTTCCAACGTGTAGGACGTGTGGGTCCTATTATTACATATTAGGTTTTTTAAAATCGTTTTTTATGACGGAGTGACTATCCTTACCACGTCATTTTATTTATGTTTTGATATTCGG
TATCTATTTGTCGTTGCTGACACGCCTTTTATAGTCATTAGGTCCCGCCGCAACGCGCGGGTGGAAAACAACTAGTTACCATTAAATATGCTGCTCCAAACATTTTATATTAATTATTTG
AATCTTACATATAACTATATTATATTATTTTTTTTACAAATAATCTTTAATATATTAGTTATCTTTTAACAAAAATGTATTTGTATTAATTGTTTTCGTTTTACAGATAAGTTTTTAACA
TTAGTTATTTTTATTTTACAAATAACATTTTTATGCGAATTATTTGAATTTTACAAAAAAAAAAAAAAAACAAAAACAAAATTTACATTAACCTAGTTATTTTACAAGTAATGATTTTAT
ATTAAATATGTTTATTTAAAGAAAATATTTCTTTAATAAATTTATATATTACAAATAATGTTCTTCAATAGAAAATTAAGTTGATGTAACTTTGTGTTTTATAGGTGGACATACAATTGG
AACAGGTGCTTGTGTAGTGTTCAGCTACAGGCTATACAACTTCAACAACACCAACCAACCCGACCCGGATATCAACCCAGCATTCCTTCCCCAGCTCCGAGCCCTTTGTCCCAATGGCGG
AGATGGGTCGAGACGCGTGGCCTTAGACACAGGCAGCGTTACGCGCTTCGATAACTCCTTTTATGCAAACTTGAGGAATGGAAGGGGAGTTCTTGAATCCGATGCAAAGCTATGGAGTGA
CCCGACAACACGACCGATCGTCCAACGGTTCCTCGGACTTAGTGGACTACTTGGATTAACATTTAATGTTGAGTTTGGAAGATCCATGGTAAAGATGGGTAACATTGAGTTGAAAACTGG
GAGTCAAGGAGAAATCCGAAGGGTTTGTAGGGCAACCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTTTATACCTTGATGTGTCTTCTATTAGCCACCCTGGCCACCATGACACAAGGCCAGACAAGGGTTGGGTTTTATAGCACCACATGTCCAAGGGTTGAAACCATAGTACGAAAT
GCGGTTCAGACTGCTGTTCGAGCCGACCCCACACTTGCAGCTGGTGTACTAAGAATATTCTTCCATGACTGCTTTGTCAATGGTTGTGATGGGTCCGTACTACTTGACGGGCCATCAAGT
GAAAAGACCGCACCACCCAACGTCCCCTTGAGAGGATTCGAGGTTATCGATGCTGCAAAATCTCAGCTCGAAACCGCCTGCCCTGGAGTGGTCTCTTGTGCTGATATTGCTGCCCTTGCT
GCCCGTGACGCGGTGGTCCTG
GCTGGTGGAACTAGTTGGCAAGTGCCATTAGGACGTAGAGATGGATTGGTTTCACAAGCATCTGATACTGTAAACTTACCTGGCTTTAATGATCCTATT
AGTGTCCAAATCAGAAAGTTTGCTGATAAAAATCTTAACATCCAAGATCTTGTTACTCTTGTTG
GTGGACATACAATTGGAACAGGTGCTTGTGTAGTGTTCAGCTACAGGCTATACAAC
TTCAACAACACCAACCAACCCGACCCGGATATCAACCCAGCATTCCTTCCCCAGCTCCGAGCCCTTTGTCCCAATGGCGGAGATGGGTCGAGACGCGTGGCCTTAGACACAGGCAGCGTT
ACGCGCTTCGATAACTCCTTTTATGCAAACTTGAGGAATGGAAGGGGAGTTCTTGAATCCGATGCAAAGCTATGGAGTGACCCGACAACACGACCGATCGTCCAACGGTTCCTCGGACTT
AGTGGACTACTTGGATTAACATTTAATGTTGAGTTTGGAAGATCCATGGTAAAGATGGGTAACATTGAGTTGAAAACTGGGAGTCAAGGAGAAATCCGAAGGGTTTGTAGGGCAACCAAC
TAA

Retrieve as FASTA