Entry information : AtAPx05 (At4g08390 / SAPX)
Entry ID 1886
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-15 (Christophe Dunand)
Peroxidase information: AtAPx05 (At4g08390 / SAPX)
Name (synonym) AtAPx05 (At4g08390 / SAPX)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Stromal
Tissue types Callus
Flower buds
Flowers
Leaves
Roots
Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtAPx05
start..stop
S start..stop
AlyAPx05 646 0 1..372 1..370
CagraAPx05 613 0 1..372 1..373
BstrAPx05 612 0 1..372 1..367
CrubAPx05 610 0 1..372 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5314999..5315232 234 N° 2 5315323..5315590 268 N° 3 5315673..5315773 101 N° 4 5315847..5315934 88
N° 5 5316056..5316123 68 N° 6 5316203..5316289 87 N° 7 5316394..5316468 75 N° 8 5316564..5316641 78
N° 9 5316727..5316831 105 N° 10 5317057..5317071 15  
join(5314999..5315232,5315323..5315590,5315673..5315773,5315847..5315934,5316056 ..5316123,5316203..5316289,5316394..5316468,5316564..5316641,5316727..5316831,53 17057..5317071)


exon

Literature and cross-references AtAPx05 (At4g08390 / SAPX)
Literature Bevan,M., Lennard,N., Quail,M., Harris,B., Rajandream,M.A., Barrell,B.G., Bancroft,I., Mewes,H.W., Mayer,K.F.X., Lemcke,K. and Schueller,C. (1999) NCBI Direct Submission.
Protein ref. UniProtKB:   Q9STM9
DNA ref. Phytozome 11:   Chr4 (5314999..5317071)
mRNA ref. GenBank:   AY056319
Cluster/Prediction ref. Phytozome Gene 11:   19644181 UniGene:   At.22866
Omic ref. AtProteome:   At4g08390 ATTED-II:   At4g08390 Broad_Colleto:   At4g08390 ePlant:   At4g08390 TAIR:   At4g08390
Protein sequence: AtAPx05 (At4g08390 / SAPX)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372
PWM (Da):   %s   40269.45  
PI (pH):   %s   8.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERVSLTLNGTLLSPPPTTTTTTMSSSLRSTTAASLLLRSSSSSSRSTLTLSASSSLSFVRSLVSSPRLSSSSSLSQKKYRIASVNRSFNSTTAATKSSSSDPDQLKNAREDIKELLSTKFCHPILVRLGWHDAGTYNKNIKEWPQRGGANGSLRFDIELKHAANAGLVNALNLIKDIKEKYSGISYADLFQLASATAIEEAGGPKIPMKYGRVDASGPEDCPEEGRLDAGPPSPATHLREVFYRMGLDDKDIVALSGAHTLGRSRPERSGWGKPETKYKEGPGAPGGQSWTPEWLKFDNSYFKEIKEKRDEDLLVLPTDAAIFEDSSFKVYAEKYAADQDAFFKDYAVAHAKLSNLGAEFNPPEGIVI*

Retrieve as FASTA  
Remarks Complete sequence from 13 cDNAs, 50 ESTs, and 1 genomic sequence. Three other transcript variants are predicted.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTCAGCCA TCTGGTCGTC GTCCGTTATA TGGACCTTTT CTTATTCTAT CGTTTTAACA TTGTAATTAC CGATTATCTT TTTTGTTGAA TAAATTTTAA ATGCTTAGGA CAAAACTAAT  ATTACATGTT GTGGTTTCGG ACCTGGAGAG ATTACAGGCT TCGGCCCAAA ACTTCCTTGT ATTAAAAAAA AAAAAAGAAT AAATTTTAAA TTCTAAATAA AAAAGATATT TACTAAGGAT  TTTTGTGAAA GCAATACTAA TTGCATTAAC ATTCATACAT GATTTGTATA ATTGTTTGGA GTTGGGTAAG ATGCTCGACT TCCACATTAG GGAACAAACA AAGCTAGATT AATGCACGTC  TAGTGAAAGA TCCATCCCTT TGATTACTTA ACTTCACATT AGGGAAAAAA CAAAGCTAGG TTCATGCACT TCTAGTGAAT GATCCATCCC TTTGATTACT TAACTTCACA TTTAGGGAAC  AAACAAAGCT AGATTCATGC ACTTCTAGGT GAAGGATATC AGGATATGCC ACATTTCTAT CAAAGAATAC GGTTAAGAAA GTCTATAGGA GGACAAAAAT AGATATGTTT TCCCAAAAAA  GATTCAAAGC TCAAGTTAAA TGGAACAATG AGTTAGCAAA AAATGGTTTA ACGGGAGGAG AAATAGTGGT AGTGTCAACC AAGTCGCCTT GGTCCAGTAG TAAAGAGAGG TAATTCCTGT  CACATGGGTT CGAGTAGCTT TGGCCACTGG GATTCGAGTA ATTTAACATG GGTTTTTTCG GGTTCCAGAA TTAGTCTTTG GACCTAGAAA CCCTTTAAGA TCACCTGAAT TATCAAAAAA  TATATATATA GTAGTAGTGT TGTGTCCTAT GTTGAAAAGT AATATGGATC AGCTTTGGAA TTCTCCAGGA AGCAATGGGA TCATGTGGGA TCAAAAAGAA TAATAAAGAG ACCACGATTG  GGCAATTACT AGGCACTTAT GTCATTGAGG TGATTAGTGG ATCATAAGAT TATGCCTACT GTTATCCTCA ATTTGACCGT ATACTATTTT CTTCTCTTTT AGCCATCCTT GAATACCTAA  CCGAGGTTCA AGAATCAGTT TATGCTTTCA TGTTGGGTTG ACCTTTGTTA AATAGGTTAT CTAGTCATGA AGAGCGAATC AAGCCAAACT CTTTTTTTTT TTTCTCTTTA ATTAAAATAG  GATTGTCTCT AAAATAAAAT TTTACCTAAT CCCCGATTTT GTAATTTTAC TTTTCATCTC AAAGAAATAC AAATTAATAT TACAAAATAA AAAAAAATAT GAAATATAAC CCGTCACCAT  TACCATCAAG TTTTCAAAGT TTTAACGAAT AATATATCAA ATCAAAACTT TCGTGATGCA GAATTCAATC TTTAGAATTT TAAACATCTA ATACATATGA TCGTAATAAA TTTTAGAATA  TACATATAAA AATGCATATT ATTTTTTACA TAATAATATC GATTTCCGTT GTTTACTATA CACGTAGCAA GACCTAAACA GTTTTAATCT GATATAGCGG AAACTAATTT TGGCACCTTA  GACAATTGAT TGGTCAATTC AACCCTCAAT AAGCCCAAGT GGAAAGACAA AGAAATTTAG GGTATTTTGT CGAATGAGAC ATAATCAACT TGACTGCTCC AATAAACTGT TTTCACTAGA  TGATGGATAG TAGTTCTGTT CTAAACATGG TTAATAGAGA TCCAAAACCC AATTTCTCTA TGGACTTTAT TGGTGCAACT CTTTAAGTGA AATTGAAACC TTACTTCAAC ACATTTCAAA  TGTATCTACC TAATTAACTC TTTATATAAA ATTAAAAAAA ACCTTAGTGC ATAAGTGGGT AGGTGAACTT GAGTCTCTTG GCAATATGTA AAGAGGCGAA ATCAAAGTTG ATCAACAATT 
AAACACAAAA ACCCTTAAGT TGACGTGGCT GTATCTCTTC CAACTCTTAA AAATCAATTA CTATTATACC CCTCAGAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGGGCACA TAATTTACTC AACCAGTAAG CTTTCTTCTT TGTATTTTGT TTTTTTTCCT CATTCGAAAT TCCAAATGTA CATGATGTTT AACTTCTTTT TAAGCAGGAC TTATGATTTT  AGAGAAACGT AGTTCAATAA TGAAAGAGAA GAAAAAGTTG ACGGAGAACT TTTCATGCGA GTACTTTTCG AGATACCTTT TGGACAATGT TTCTGGCTGT TCAAAGGATT TTGTTTAGCC  GAAAGTATTT GATCGTTTTC ATGGTTTTGG GCTTTCATGT TTTTTCTTGT AATAAATTGC GGAAGTGATT ATTCAAAATC TATACAAATT TTGTCTGGGA TTGAATTATT TTATCGATGT  TATAACTACA CACCCTTGGT TTTGTAGCTC AAGAGTAGCG TTGTGCCCAA TTTATCTGTC TTCTCGAAAC CTTTCAGGTA AGAGTTCATG TATCTCAATT CTCGAACAAT GGACCGAAGT  GTGATTGCTA AAACCCACAC CCGGAATTTG TATATAGGGT TTATGAGGAA AGAGGCTAGA TTTTCTCAGG GAACTAAATG AAAAGAAATG ATGTGAATGA AATTTGTATA TGAGATCAGA  TCAAGAGATT GAGGTTTACA AAGTGATTTT TCTGTTAAGT GTCGTTTGGG TTGAACTTCC TCCTCCGAGA TTGGCGGTCC TTTAATCTCT CTTTGTTGAC TATGCTTAGA CTATCTCCAA  TGTAGAACTC TATATTTTTC TCTATTTTAG AGGTGACTAT ATTTTAGAGT AAATATAATT GATTTTTCTC TATTGTATGA CTATAAAATA GAGGAAAAGT TTAGAGATTG CTCTTTTTTG  CTGTATATAT AGACTTTTTC TGTATTTTAG AGTTAACTCT ATTTTAGAGT TATACAATGA AGCAAAATCA ACTATAATTA CTCTAAAATA TAGTCAATTC TAAAATAGAG AAAAATATAG 
AGTTGGGCAT TGGAGATGCT CTTAGCTTTT TGGCTCATCC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCGTGTGTCTCTCACACTCAACGGAACCCTCCTTTCTCCTCCTCCCACAACAACAACAACAACAATGTCTTCTTCTCTCCGATCTACCACCGCCGCTTCTCTTCTCCTCCGC
TCCTCCTCCTCCTCCTCCAGATCCACTCTCACTCTCTCCGCTTCCTCCTCTCTCTCCTTCGTCAGATCTCTCGTCTCTTCTCCACGTCTCTCTTCTTCTTCATCCCTCTCTCAG
GTATAT
CTTCACTCTCTCCCTTCCAATTTCCTTTATCTCTTCTATATCTGAATCTGATTTTGTAATTTCCACGATCTAATTTGATTTCAGAAGAAATATCGAATTGCGTCGGTGAATCGGAGTTTC
AACTCCACCACCGCCGCTACTAAATCTTCATCTTCAGATCCTGATCAGTTGAAGAACGCTAGAGAAGATATCAAAGAGCTTCTCAGCACCAAATTCTGCCATCCGATTTTGGTTAGATTA
GGTTGGCATGATGCTGGTACGTATAACAAGAACATTAAGGAATGGCCACAAAGAGGTGGAGCTAATGGAAGTTTGAGATTCGATATTGAGCTTAAACATGCTGCTAACGCTG
GTACCTAT
AAGCTTTATACCATTATTACGAGTTAGTGTTATTTAGTTGTTTGCTATAAGCATTGTTTGTTGGTTGTTATTAGGTCTTGTGAATGCTTTAAACTTGATTAAGGATATCAAAGAGAAATA
CTCTGGGATCAGTTATGCTGATTTGTTCCAGTTAGCTAGTGCTACTGCTATAGAG
GTGAGGTTAATAGTTCTTAAAGGTAGTTTTTAGTTGTTGTGAATAGGTTTAGTAAAGTTTTGGTG
AGTTTTAGGAAGCTGGAGGACCGAAAATACCGATGAAATATGGTAGAGTTGATGCCTCTGGTCCTGAGGATTGTCCAGAAGAAGGAAGGCTTCCAGGTAAAGCGTCTCATTTATCGGCTT
TGCCTCTGGTTCTTCGTATAACGTGGTTGTACTTTGGTTACATCATTCTATCAAATTTTTGTACTAATTATTGTATGTTTGCTCTTATGTTCGATAGATGCTGGTCCTCCTTCACCTGCT
ACTCATCTCAGAGAAGTTTTTTACAGAATGGGATTAGATGACAAG
GTGATTGCGGTTGAATTTTTTTTTAATCGTTATGGAAGATCGAGAAGTAAGCCATATTGAAAGATTATTGTAAGT
GCAGGACATAGTTGCATTATCTGGTGCTCACACGTTAGGAAGATCTAGGCCAGAACGTAGTGGTTGGGGGAAGCCTGAGACGAAGTACACGGTATTATCCAGTTCTATAACGTATTGTTA
TATATGATACTGCAAATGGATCAGAACACTTTGAATATATAGTTCTTACTATGTGTTTTTTTTTTGGCATTGTAGAAAGAAGGACCTGGAGCACCAGGAGGACAGTCATGGACACCAGAG
TGGCTGAAGTTTGATAATTCTTACTTCAAG
GTTGCGTTTCAGAACTTTAACTCTATCTTCACACTTTGTATTTGAAAGTCTTCCTTTTTGTTTTTTCATGTTTATTAATATAGTTGTTTC
AACAGGAGATCAAGGAAAAGAGAGATGAAGATCTCCTTGTCCTACCCACTGATGCTGCCATCTTCGAAGATTCTTCTTTCAAGGTAACAAACTGAGGTTGAAACATATCAATACGAAGAA
ACTTACTAAGTCTTTGCCTTTAAAACTGAAACTTCATTGCAATTGCAGGTCTATGCTGAAAAGTATGCTGCAGATCAGGATGCATTTTTCAAGGATTACGCTGTAGCCCATGCGAAGCTC
AGCAATCTTGGAGCAGAATTTAACCCTCCGGAG
GTATGCATTCCTTTGATTTCTGTCATTTGTATTATCATCTTTAACGAAAATCGACCTTCAAATCAATTTTTTCGTCTACATAGAAAA
TGTACACTGGAGCTATAGAAAATCTAAGTACTGTTGGTTTAGAATAGATAGATATCTTCTTTTTGGCGTTTAAGGAGTCTCCATTGATGAATAAATTCGCGGGTCTTAAGAACTGATTAA
TGTGAATCTTTTGTGTAGGGTATCGTTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCGTGTGTCTCTCACACTCAACGGAACCCTCCTTTCTCCTCCTCCCACAACAACAACAACAACAATGTCTTCTTCTCTCCGATCTACCACCGCCGCTTCTCTTCTCCTCCGC
TCCTCCTCCTCCTCCTCCAGATCCACTCTCACTCTCTCCGCTTCCTCCTCTCTCTCCTTCGTCAGATCTCTCGTCTCTTCTCCACGTCTCTCTTCTTCTTCATCCCTCTCTCAG
AAGAAA
TATCGAATTGCGTCGGTGAATCGGAGTTTCAACTCCACCACCGCCGCTACTAAATCTTCATCTTCAGATCCTGATCAGTTGAAGAACGCTAGAGAAGATATCAAAGAGCTTCTCAGCACC
AAATTCTGCCATCCGATTTTGGTTAGATTAGGTTGGCATGATGCTGGTACGTATAACAAGAACATTAAGGAATGGCCACAAAGAGGTGGAGCTAATGGAAGTTTGAGATTCGATATTGAG
CTTAAACATGCTGCTAACGCTG
GTCTTGTGAATGCTTTAAACTTGATTAAGGATATCAAAGAGAAATACTCTGGGATCAGTTATGCTGATTTGTTCCAGTTAGCTAGTGCTACTGCTATA
GAG
GAAGCTGGAGGACCGAAAATACCGATGAAATATGGTAGAGTTGATGCCTCTGGTCCTGAGGATTGTCCAGAAGAAGGAAGGCTTCCAGATGCTGGTCCTCCTTCACCTGCTACTCAT
CTCAGAGAAGTTTTTTACAGAATGGGATTAGATGACAAG
GACATAGTTGCATTATCTGGTGCTCACACGTTAGGAAGATCTAGGCCAGAACGTAGTGGTTGGGGGAAGCCTGAGACGAAG
TACACG
AAAGAAGGACCTGGAGCACCAGGAGGACAGTCATGGACACCAGAGTGGCTGAAGTTTGATAATTCTTACTTCAAGGAGATCAAGGAAAAGAGAGATGAAGATCTCCTTGTCCTA
CCCACTGATGCTGCCATCTTCGAAGATTCTTCTTTCAAG
GTCTATGCTGAAAAGTATGCTGCAGATCAGGATGCATTTTTCAAGGATTACGCTGTAGCCCATGCGAAGCTCAGCAATCTT
GGAGCAGAATTTAACCCTCCGGAG
GGTATCGTTATCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTGATCAAC AATTAAACAC AAAAACCCTT AAGTTGACGT GGCTGTATCT CTTCCAACTC TTAAAAATCA ATTACTATTA TACCCCTCAG AAAAATGGCA GAGCGTGTGT CTCTCACACT  CAACGGAACC CTCCTTTCTC CTCCTCCCAC AACAACAACA ACAACAATGT CTTCTTCTCT CCGATCTACC ACCGCCGCTT CTCTTCTCCT CCGCTCCTCC TCCTCCTCCT CCAGATCCAC  TCTCACTCTC TCCGCTTCCT CCTCTCTCTC CTTCGTCAGA TCTCTCGTCT CTTCTCCACG TCTCTCTTCT TCTTCATCCC TCTCTCAGAA GAAATATCGA ATTGCGTCGG TGAATCGGAG  TTTCAACTCC ACCACCGCCG CTACTAAATC TTCATCTTCA GATCCTGATC AGTTGAAGAA CGCTAGAGAA GATATCAAAG AGCTTCTCAG CACCAAATTC TGCCATCCGA TTTTGGTTAG  ATTAGGTTGG CATGATGCTG GTACGTATAA CAAGAACATT AAGGAATGGC CACAAAGAGG TGGAGCTAAT GGAAGTTTGA GATTCGATAT TGAGCTTAAA CATGCTGCTA ACGCTGGTCT  TGTGAATGCT TTAAACTTGA TTAAGGATAT CAAAGAGAAA TACTCTGGGA TCAGTTATGC TGATTTGTTC CAGTTAGCTA GTGCTACTGC TATAGAGGAA GCTGGAGGAC CGAAAATACC  GATGAAATAT GGTAGAGTTG ATGCCTCTGG TCCTGAGGAT TGTCCAGAAG AAGGAAGGCT TCCAGATGCT GGTCCTCCTT CACCTGCTAC TCATCTCAGA GAAGTTTTTT ACAGAATGGG  ATTAGATGAC AAGGACATAG TTGCATTATC TGGTGCTCAC ACGTTAGGAA GATCTAGGCC AGAACGTAGT GGTTGGGGGA AGCCTGAGAC GAAGTACACG AAAGAAGGAC CTGGAGCACC  AGGAGGACAG TCATGGACAC CAGAGTGGCT GAAGTTTGAT AATTCTTACT TCAAGGAGAT CAAGGAAAAG AGAGATGAAG ATCTCCTTGT CCTACCCACT GATGCTGCCA TCTTCGAAGA  TTCTTCTTTC AAGGTCTATG CTGAAAAGTA TGCTGCAGAT CAGGATGCAT TTTTCAAGGA TTACGCTGTA GCCCATGCGA AGCTCAGCAA TCTTGGAGCA GAATTTAACC CTCCGGAGGG  TATCGTTATC TAATGGGGGC ACATAATTTA CTCAACCAGA CTTATGATTT TAGAGAAACG TAGTTCAATA ATGAAAGAGA AGAAAAAGTT GACGGAGAAC TTTTCATGCG AGTACTTTTC  GAGATACCTT TTGGACAATG TTTCTGGCTG TTCAAAGGAT TTTGTTTAGC CGAAAGTATT TGATCGTTTT CATGGTTTTG GGCTTTCATG TTTTTTCTTG TAATAAATTG CGGAAGTGAT 
TATTCAAAAT CTATACAAAT TTTGTCTGGG ATTGAATTAT TTTATCGATG TTATAACTAC ACACCCTTGG TTTTGT 

Retrieve as FASTA