Entry information : AtAPx06 (At1g77490 / TAPX)
Entry ID 1889
Creation 2006-09-04 (Christophe Dunand)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtAPx06 (At1g77490 / TAPX)
Name (synonym) AtAPx06 (At1g77490 / TAPX)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Thylakoid-bound
Tissue types Flower buds
Flowers
Leaves
Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtAPx06
start..stop
S start..stop
AlyAPx06 790 0 1..426 1..429
AhalAPx08 776 0 1..426 1..424
CagraAPx06 745 0 1..426 1..430
CrubAPx06 743 0 1..426 1..430
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29117688..29117870 183 N° 2 29117938..29118072 135 N° 3 29118212..29118332 121 N° 4 29118414..29118514 101
N° 5 29118607..29118694 88 N° 6 29118798..29118865 68 N° 7 29118950..29119036 87 N° 8 29119127..29119201 75
N° 9 29119310..29119387 78 N° 10 29119483..29119587 105 N° 11 29119715..29119774 60 N° 12 29119867..29120046 180
join(29117688..29117870,29117938..29118072,29118212..29118332,29118414..29118514 ,29118607..29118694,29118798..29118865,29118950..29119036,29119127..29119201,291 19310..29119387,29119483..29119587,29119715..29119774,29119867..29120046)


exon

Literature and cross-references AtAPx06 (At1g77490 / TAPX)
Literature Jespersen,H.M., Kjaersgard,I.V., Ostergaard,L. and Welinder,K.G. (1997) From sequence analysis of three novel ascorbate peroxidases from Arabidopsis thaliana to structure, function and evolution of seven types of ascorbate peroxidase. Biochem. J. 326 (PT 2), 305-310.
Protein ref. UniProtKB:   Q9CAQ6
DNA ref. Phytozome 11:   Chr1 (29117688..29120046)
mRNA ref. GenBank:   X98926
Cluster/Prediction ref. Phytozome Gene 11:   19654802 UniGene:   At.25463
Omic ref. ePlant:   At1g77490 TAIR:   At1g77490
Protein sequence: AtAPx06 (At1g77490 / TAPX)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   426
PWM (Da):   %s   45916.53 Transmb domain:   %s   o397-419i
PI (pH):   %s   7.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVSLSAASHLLCSSTRVSLSPAVTSSSSSPVVALSSSTSPHSLGSVASSSLFPHSSFVLQKKHPINGTSTRMISPKCAASDAAQLISAKEDIKVLLRTKFCHPILVRLGWHDAGTYNKNIEEWPLRGGANGSLRFEAELKHAANAGLLNALKLIQPLKDKYPNISYADLFQLASATAIEAGGPDIPMKYGRVDVVAPEQCPEEGRLPDAGPPSPADHLRDVFYRMGLDDEIVALSGAHTLGRARPDRSGWGKPETKYTKTGPGEAGGQSWTVKWLKFDNSYFKDIKEKRDDDLLVLPTDAALFEDPSFKNYAEKYAEDVAAFFKDYAEAHAKLSNLGAKFDPPEGIVIENVPEKFVAAKYSTGKKELSDSMKKKIRAEYEAIGGSPDKPLPTNYFLNIIIAIGVLVLLSTLFGGNNNSDFSGF*

Retrieve as FASTA  
Remarks Complete sequence from 6 cDNAs, 22 ESTs, and 1 genomic sequence (chromo 1, 11 introns).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTTGTCGTT AAAGAGAAGC TCTGCTGGTC CAGCCATGTA GTTTTTACTA CAGAAAAAAT TCACACCATA ATTTCAACTT GTCAATTATA AAAGTGTGAG TAAACAAGTG GCAGTTATAA  AGAAGATAAT GCTCAAAGAT TGCTCACCTA GGTGAATTAG TAGCCAATGA AGTCCATGTA ACTCCAGAAG AAGGAACAAG CTCATCTCCA ATAGAGAGAA AGCCTTTACC AGTATGACTT  AAGCAATGCA CAATCACATT CTTCGTTATC CCCAAGGACT TTAGCTGAGT TGAGAGGCCT ACTTTCCCTC TTCCAAGGCC AAGTATTCCC GCTGTTGGAG GAGGAGGATG TGGACCAGGA  TTCTGCTGAT CATACCCACA TCTAAAAGAA AATTTGATTC AAAAATTAGG AACTTGTACA ACCGCAAATT TAGTGTTTTT CTTTTCTAAT GTGTGAAAAA AGGTAGAATA AAACTAACCC  AAATGTCAAA CGAAGATTCA TAATGGAGCC ATTTGCGAGT TTTAGAGGAA CCTCATCAGT TACAAGTGCA CCAATAGATG ATGCATGATC GGAGTATCCG ATTTCATAGT CACATTGATC  CTCAGGGTCA GCACAAGGTC TGTCCTGGGG AAGGTCAAGA CCAGAACACA AGATGTGTGA ACAAGGCAAA GTGTTGTGAT TGGGCTTGTA CTGCTTAGCA CGAGGCTGCA AAGAAAGAGA  AAGAAATTCT AAGATAGAAC CTTTGCTTAT TATGTCACAC ACTAAAAAGC ATATCAACGC TTACCTTTGT GCAACCGTTG CAAGGTGCAT CACACTGAAC CCAAGTGAGG TCACTGCCAG  TGTCAATGTC CAAGTCAAAG AGCTTAGGTG GGTTGCCAAT GTTAAGCAAC ACATAATAGT ACCTGCAAAG ATGAATTCGT TAATTACTTC AACAATCAAA TTGGGCGTTT TCAATACAAG  GTGAAAATCA GAATCAACAT TGCCCAAAAT CTTCAATTCG TGAAAGTAGC AAGCTTTGAA ATCATCTCAA AGATCAATAG AATGAAGATT TCACATCTTG TCAAGCAATG AAATAGATTA  CAAGTGAAGA ATCCACACAG ATGCAAGAGA AGCCAACAAA GTATCCGCAC CAATTCAAAA TCCAGACATA AGTCAACACA ATCCCGTTAA GGAAAATCAA AGAAACAAGA TCAAACCCAC  GAATGGGTCA CTGAAAAGTA GCATAAAACA GAGAAATTGA AACAAAAAGA TGCGAAATTT GGCACTTACC CAAGAGGATA CACATTCCCG GAGACAGGAA ACACGACGGT GGAGCTAAGT  CGACGATTCT GTAACTTCAC TTGAGCCGAC GAGTCTTTAG TAGCTTCAGA GGTTTGAAAG CGAGCACAGA GGATGAAGAC ATAGAAGACG AAGACGAAGA AGAAGTAAAG GTTTCTTCTT  TGCTGCTTAT TCGGATTCAT CATCTCCTCT TTTTGGCCCC CAAGAAAGCG AAACCAAATC CCACCAAAAA GGTTTCTTTT TTGACACAGG GCAACAAAAA GGAGGCTTTT TCTTTGTAGA  ATTGCTGCTC CCTTATAGGA GTGAGTATTT GTTTATATAT CTGATCTCTC TCACACTCAA TTTCGTGCAA CTTGCAGCAG AGGTTTCTTT GAGTTCCCGT AAGCTAAATT GAGAAACTTG  GCATTTGGCT AAAAGAAACT CAACGCCCAA CGCTCACTAC ACTTAGCGTG TAAAGCACGC GCCAACCAGG ATTGACTCAA AGGCCTAACG ATCTTCAAAT GTACAGGGCC CAATATACTC  GGCCCATAAA CTCTAAAACT ATTCAAATGT TAGGCGCGTG ACGTTCACCT GTGAATCAGC TGATAGAAAT CATTATCCAA TATCCAGTTA TGAGTGGGTG ACTCCAAATA GATCCAACTG 
GCAACGCATT ATTGACACGT GTCTTTTCAT TTCTCTTCTT CCGGCGTTTT CTCTCCGCCG TTTCGCCACC GTACGTGACA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTGACAAATT ATATATTTTG ATTTCTCTTA CCTACATACA TAATTACGTG GTGATCATAT ATTCCTTGCA AACAAAAACA TCATTGTTAA AGTTTGCTTG AATAAAATCA CCTTATAAAT  AACATTGTTT ATTTGGTTTT TAGAATTTTG AGATTAGTGT GAGTTTCTTA AGTATAGGAT ACTAAAATAA TGTGTGTGAA TCACTGCTAC GCCTTTGCAC GAATAGATTC AAAAATTAAA  ATAAGTTTTT TTGAGATTCA TTAAAGATTC TTCTCTTTTT GTAAAGAAAG AAAAGTCTTG TCGCTTGGAT TAGGTTAACC ATCGACCATC GTACTTGTTT CCAAATCTAT ACAAACAAAG  GTGATTATTT TTTTCATGAA CAGGTTTAGA GAACTTTTAC AACACCACGT GTGACATAAT AAACGTGCAT AGTTATGCTT GATCGGTCCT TCTCTTCTCA ATTTTTTTAA TACCCAGGAA  GACTATTGGC TAACTAATAT TTAGTTTGTT GGGATAATCA ATGTGTACTT AACAACAACC AACTTTAAAT ATTAAATTCT GAATCTAGAA AGATGTATGA ATTTAGGTTG GTATGGAAAA  TGATGTTCCT TCTTCTAGTG ACGCAAGAAT GCTTACGGTG AACCGATGGG ATTGGTCAGA CTCAATCAAT CCCATTGTTC TAATCGATAT TTGAAACTTT TCCCTCTTTT ACTTTTGTAT 
ATATGATTGA GCTTATGTTT CCTCTGTATT TTATGACGAA ACTAATTTCA TATAGTATAT TGCAATCATG TTAGTATTAT A 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGTTTCTCTCTCCGCCGCCTCTCACTTACTCTGTTCCTCCACCAGAGTCTCTCTTTCCCCCGCCGTCACCTCTTCGTCCTCGTCCCCTGTCGTTGCTCTTTCTTCCTCTACATCG
CCACATTCTCTTGGAAGCGTCGCATCTTCTTCTCTGTTTCCTCACTCCTCCTTCGTGCTTCAG
GTATTCGTACTTCATTCATACTTTTTGTAAATTTCTCTCCGAACATAACATTTTCTG
TTGATTTTAGAAAAAACATCCGATCAATGGGACGAGCACGAGGATGATTTCACCAAAATGTGCCGCTTCTGATGCAGCTCAATTGATAAGCGCTAAAGAAGATATCAAAGTTCTTCTCCG
GACTAAGTTTTGCCATCCCATCTTG
GTGAAGTATCTTTCTCTTCTTCATGATGATAGGACAGGGAATTTTTGAATTCATGGAAGTAATAGTTCTTTGCTTGTTACTAAAGATATTGGAGG
AATTTTGTGAGTCATGTTGCTTTGTGTTACATGTTTCATTGCAGGTTAGATTGGGGTGGCACGATGCTGGTACTTATAACAAGAATATTGAGGAGTGGCCACTGAGAGGTGGAGCTAATG
GAAGTCTTAGGTTTGAGGCTGAGCTTAAGCATGCTGCAAATGCTG
GTACTGGTTTCATCATTTCACATGCATTGTGGCTTAAGACTTTTATTTGGTGTCTTGATATTCTACTTTTGACAT
TTACAGGTCTGCTTAATGCTTTAAAGCTCATTCAGCCTCTCAAAGACAAGTATCCTAACATCTCTTATGCGGACTTATTCCAGTTAGCTAGTGCCACAGCAATAGAGGTCTTTCTTCACT
TTTCTTGGGCTTGGCCTATTAGGAAACTATTTTGGTCTTAAGGCTTTACTGATAACTCTAGAAATAAATAAAACTTCAGGAGGCTGGTGGTCCTGATATCCCGATGAAATATGGGAGAGT
TGATGTTGTAGCACCTGAACAGTGTCCAGAAGAAGGAAGACTCCCTG
GTTAACTAATCTTTCCATTGTCTGTTTCATGTCTTCTATGAGTTTGTTTCAGATTTTGTTTATGGACTAATTG
AAATAACGAGGTGAAATATGCTATGTTTAGATGCTGGACCTCCTTCACCAGCTGATCATTTGAGAGATGTTTTCTACAGAATGGGACTTGATGACAAGGTTATTTTGATTTTGTTCTCTT
TTGTGTTATTCATGTCAAACGTGAATATTTTTGTTATTCTGAATATTCTTTTTGACAAACAGGAAATAGTTGCCTTGTCTGGTGCACATACCTTAGGGAGAGCCAGACCAGACCGTAGTG
GTTGGGGAAAACCTGAGACAAAGTACACG
GTATTAATAAACGACAAACTGAAGCTACCTTATATATAGTTCTAGGGATGATAGTGTAGAGAGATGTTATGGAAACGTTCAAAATGGCAGA
AAACTGGACCTGGAGAAGCAGGAGGACAGTCATGGACAGTGAAATGGCTCAAGTTCGACAACTCTTATTTCAAG
GTCTATCTCTCTATCTTTCTTAGTAACTTGGTTTGGGACTGAAAAA
GAGTTTTCTATGAAGTTTTCTAAAAATAGTTTTATCAACCATTGACTTCTATGACTTTGCAGGATATCAAAGAAAAGAGGGACGACGATCTTCTGGTGTTACCCACTGATGCGGCGCTAT
TTGAAGATCCTTCATTCAAG
GTTTAAACAACAGTGATTGCTAATAAGATGCCTCAGAATTAGTAGTTCACTGTTACTTAAGAGGAAATGTTTTTAAAAACAATAGTTTCTTACAGAACTA
TGCAGAGAAGTATGCTGAAGATGTGGCTGCATTTTTCAAGGACTACGCTGAAGCCCATGCCAAGCTTAGCAATCTCGGTGCAAAATTTGATCCTCCCGAG
GTACAAGGAAAGGGGAGAAA
ATCTAATATCTATGCACTTGTGTATACCATTATAAACCATACGTTTAAAATCCAGTTCAGTGACTTAAAATCTAAAACTGCTAATGTGTCACTATGAAACTAATCAGGGCATAGTCATTG
AAAACGTTCCAGAGAAGTTCGTAGCTGCAAAGTATTCTACGGGAAAG
GTTTGTCCTTACAAAACAAAAATGCGCTTGTGTAGCTTATTCTAATATAGGATTCGGTTCTTGTTTTTAATCT
CTCCGGCAATATTTTGCAGAAGGAGCTTTCGGATTCGATGAAAAAGAAGATAAGAGCAGAGTATGAAGCAATTGGAGGAAGCCCAGATAAGCCATTACCCACAAATTACTTCCTCAACAT
CATAATTGCCATTGGCGTTTTGGTCCTCTTGTCCACTCTCTTTGGTGGTAATAACAACTCCGATTTCTCTGGTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGTTTCTCTCTCCGCCGCCTCTCACTTACTCTGTTCCTCCACCAGAGTCTCTCTTTCCCCCGCCGTCACCTCTTCGTCCTCGTCCCCTGTCGTTGCTCTTTCTTCCTCTACATCG
CCACATTCTCTTGGAAGCGTCGCATCTTCTTCTCTGTTTCCTCACTCCTCCTTCGTGCTTCAG
AAAAAACATCCGATCAATGGGACGAGCACGAGGATGATTTCACCAAAATGTGCCGCT
TCTGATGCAGCTCAATTGATAAGCGCTAAAGAAGATATCAAAGTTCTTCTCCGGACTAAGTTTTGCCATCCCATCTTG
GTTAGATTGGGGTGGCACGATGCTGGTACTTATAACAAGAAT
ATTGAGGAGTGGCCACTGAGAGGTGGAGCTAATGGAAGTCTTAGGTTTGAGGCTGAGCTTAAGCATGCTGCAAATGCTG
GTCTGCTTAATGCTTTAAAGCTCATTCAGCCTCTCAAAGAC
AAGTATCCTAACATCTCTTATGCGGACTTATTCCAGTTAGCTAGTGCCACAGCAATAGAG
GAGGCTGGTGGTCCTGATATCCCGATGAAATATGGGAGAGTTGATGTTGTAGCACCTGAA
CAGTGTCCAGAAGAAGGAAGACTCCCTG
ATGCTGGACCTCCTTCACCAGCTGATCATTTGAGAGATGTTTTCTACAGAATGGGACTTGATGACAAGGAAATAGTTGCCTTGTCTGGTGCA
CATACCTTAGGGAGAGCCAGACCAGACCGTAGTGGTTGGGGAAAACCTGAGACAAAGTACACG
AAAACTGGACCTGGAGAAGCAGGAGGACAGTCATGGACAGTGAAATGGCTCAAGTTC
GACAACTCTTATTTCAAG
GATATCAAAGAAAAGAGGGACGACGATCTTCTGGTGTTACCCACTGATGCGGCGCTATTTGAAGATCCTTCATTCAAGAACTATGCAGAGAAGTATGCTGAA
GATGTGGCTGCATTTTTCAAGGACTACGCTGAAGCCCATGCCAAGCTTAGCAATCTCGGTGCAAAATTTGATCCTCCCGAG
GGCATAGTCATTGAAAACGTTCCAGAGAAGTTCGTAGCT
GCAAAGTATTCTACGGGAAAG
AAGGAGCTTTCGGATTCGATGAAAAAGAAGATAAGAGCAGAGTATGAAGCAATTGGAGGAAGCCCAGATAAGCCATTACCCACAAATTACTTCCTCAAC
ATCATAATTGCCATTGGCGTTTTGGTCCTCTTGTCCACTCTCTTTGGTGGTAATAACAACTCCGATTTCTCTGGTTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCAGCTGAT AGAAATCATT ATCCAATATC CAGTTATGAG TGGGTGACTC CAAATAGATC CAACTGGCAA CGCATTATTG ACACGTGTCT TTTCATTTCT CTTCTTCCGG CGTTTTCTCT  CCGCCGTTTC GCCACCGTAC GTGACAATGT CTGTTTCTCT CTCCGCCGCC TCTCACTTAC TCTGTTCCTC CACCAGAGTC TCTCTTTCCC CCGCCGTCAC CTCTTCGTCC TCGTCCCCTG  TCGTTGCTCT TTCTTCCTCT ACATCGCCAC ATTCTCTTGG AAGCGTCGCA TCTTCTTCTC TGTTTCCTCA CTCCTCCTTC GTGCTTCAGA AAAAACATCC GATCAATGGG ACGAGCACGA  GGATGATTTC ACCAAAATGT GCCGCTTCTG ATGCAGCTCA ATTGATAAGC GCTAAAGAAG ATATCAAAGT TCTTCTCCGG ACTAAGTTTT GCCATCCCAT CTTGGTTAGA TTGGGGTGGC  ACGATGCTGG TACTTATAAC AAGAATATTG AGGAGTGGCC ACTGAGAGGT GGAGCTAATG GAAGTCTTAG GTTTGAGGCT GAGCTTAAGC ATGCTGCAAA TGCTGGTCTG CTTAATGCTT  TAAAGCTCAT TCAGCCTCTC AAAGACAAGT ATCCTAACAT CTCTTATGCG GACTTATTCC AGTTAGCTAG TGCCACAGCA ATAGAGGAGG CTGGTGGTCC TGATATCCCG ATGAAATATG  GGAGAGTTGA TGTTGTAGCA CCTGAACAGT GTCCAGAAGA AGGAAGACTC CCTGATGCTG GACCTCCTTC ACCAGCTGAT CATTTGAGAG ATGTTTTCTA CAGAATGGGA CTTGATGACA  AGGAAATAGT TGCCTTGTCT GGTGCACATA CCTTAGGGAG AGCCAGACCA GACCGTAGTG GTTGGGGAAA ACCTGAGACA AAGTACACGA AAACTGGACC TGGAGAAGCA GGAGGACAGT  CATGGACAGT GAAATGGCTC AAGTTCGACA ACTCTTATTT CAAGGATATC AAAGAAAAGA GGGACGACGA TCTTCTGGTG TTACCCACTG ATGCGGCGCT ATTTGAAGAT CCTTCATTCA  AGAACTATGC AGAGAAGTAT GCTGAAGATG TGGCTGCATT TTTCAAGGAC TACGCTGAAG CCCATGCCAA GCTTAGCAAT CTCGGTGCAA AATTTGATCC TCCCGAGGGC ATAGTCATTG  AAAACGTTCC AGAGAAGTTC GTAGCTGCAA AGTATTCTAC GGGAAAGAAG GAGCTTTCGG ATTCGATGAA AAAGAAGATA AGAGCAGAGT ATGAAGCAAT TGGAGGAAGC CCAGATAAGC  CATTACCCAC AAATTACTTC CTCAACATCA TAATTGCCAT TGGCGTTTTG GTCCTCTTGT CCACTCTCTT TGGTGGTAAT AACAACTCCG ATTTCTCTGG TTTCTAATTG ACAAATTATA  TATTTTGATT TCTCTTACCT ACATACATAA TTACGTGGTG ATCATATATT CCTTGCAAAC AAAAACATCA TTGTTAAAGT TTGCTTGAAT AAAATCACCT TATAAATAAC ATTGTTTATT 
TGGTTTTTAG AATTTTGAGA TTAGTGTGAG TTTCTT 

Retrieve as FASTA