Entry information : ZmPrx03_B73 (pox3 / GRMZM2G135108 [6a])
Entry ID 19
Creation 2006-08-28 (Christophe Dunand)
Last sequence changes 2011-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmPrx03_B73 (pox3 / GRMZM2G135108 [6a])
Name (synonym) ZmPrx03_B73 (pox3 / GRMZM2G135108 [6a])
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Leaves
Silks
Inducer Lignification
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx03_B73
start..stop
S start..stop
ZmPrx03_F66 726 0 4..360 1..357
ZmPrx03_Wis93 725 0 4..360 1..357
ZmPrx03_Du101 725 0 4..360 1..357
ZmPrx03_W64A 724 0 4..360 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 125011409..125011624 216 N° 2 125011740..125012198 459 N° 3 125012298..125012705 408  
join(125011409..125011624,125011740..125012198,125012298..125012705)


exon

Literature and cross-references ZmPrx03_B73 (pox3 / GRMZM2G135108 [6a])
Literature REFERENCE 1 de Obeso,M. et al., Gene 309 (1), 23-33 (2003).

REFERENCE 2 Guillet-Claude,C., Birolleau-Touchard,C., Manicacci,D., Rogowsky,P.M., Rigau,J., Murigneux,A., Martinant,J.P. and Barriere,Y. Nucleotide diversity of the ZmPox3 maize peroxidase gene: relationships between a MITE insertion in exon 2 and variation in forage maize digestibility. BMC Genet. 5 (1), 19 (2004)
Protein ref. UniProtKB:   Q6RFK3
mRNA ref. GenBank:   AY500792
Cluster/Prediction ref. UniGene:   Zm.2766
Protein sequence: ZmPrx03_B73 (pox3 / GRMZM2G135108 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (336)
PWM (Da):   %s   38560.47 (35942.1)  
PI (pH):   %s   6.96 (5.73) Peptide Signal:   %s   cut: 25 range:25-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTTKRHCLRFTTVLATTLLSATAACLDVGFYDRTCPTAETIVQQTVAAAFRNNSGVAPALIRMHFHDCFVRGCDGSVLIDTVGNLTAEKDAPPNNPSLRFFDVVDRAKASLEAQCPGVVSCADVLAFAARDSVVLSGGLGYQVPAGRRDGRISNDTEALNNLPPPFFNATELADRFASKNLTIEDLVVLSGAHTIGVSHCSGFAGPTDLNGPVDRLYNFSSPDGIDPTLSKAYAFLLKSICPANTSQFFPNTTVFMDLITPERFDNKYYVGLTNNLGLFKSDVALLTNATMKALVDSFVRSEATFRTKFARSMIKMGQIEVLTGTQGEIRRNCRVINPVSATDDVVLARPSGFTGVAAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, intron 1 and 3') and mRNA. relationships with variation in cell wall digestibility. Containing IntR (3'). Also present in different cultivars with a MITE seq in the exon 2: B73 (AY500800), EP1 (AY500797), F120 (AY500809), F7 (AY508516), F226 (AY508161), F227 (AY508162), F271 (AY500812), F286 (AY500796), F324 (AY508163), F564 (AY500792), F64 (AY500794), F7012 (AY508160), F7025 (AY500804), MBS847 (AY500805), Quebec28 (AY500781, AY508159), W117 (AY500808), W64A (AY500789), GeneChip® Maize Genome Array ID: Zm.2766.1.A1_at
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGAAGCGGCACTGCTTGCGCTTCACCACCGTCCTGGCGACGACGCTTCTCTCCGCCACCGCCGCCTGCCTCGACGTCGGCTTCTACGACAGGACATGCCCCACTGCCGAG
ACCATCGTGCAGCAGACCGTGGCGGCCGCGTTCAGGAACAACTCCGGCGTCGCTCCGGCGCTGATCCGCATGCACTTCCATGACTGCTTTGTCAGG
GTAATTAAGCTCACGCATGCATGT
GGCTAGAAGACATGCTGTTTTTTTTTCCCTCTCCACACGAGCGAGTGACTGTACGTACGCGCGCGGGCTCTAAACTCCTTGCTTGCTGCAGGGCTGCGATGGCTCGGTGCTGATCGACAC
GGTAGGCAACCTGACGGCGGAGAAGGACGCGCCACCCAACAACCCCAGCCTCCGGTTCTTCGACGTGGTCGACCGTGCCAAGGCGTCACTGGAGGCTCAGTGCCCCGGCGTGGTCTCCTG
CGCCGACGTGCTCGCCTTCGCGGCCAGGGACAGCGTCGTGCTCTCCGGTGGCCTCGGCTACCAGGTGCCGGCCGGACGCCGTGACGGGCGGATATCCAATGACACCGAAGCCCTCAACAA
CCTGCCTCCGCCGTTCTTCAACGCCACCGAGCTGGCAGACAGGTTCGCCTCCAAGAACCTCACTATCGAGGACCTGGTCGTGCTCTCCGGCGCGCACACCATCGGCGTCTCGCACTGCAG
CGGCTTCGCCGGCCCGACAGACCTGAACGGCCCCGTTGACCGGCTCTACAACTTCAGCTCGCCTGACGGG
GTAGGGGCATCGTCTGTCACCTCGCTCTCTGCAAAACCTTGAATGCGAAA
AAAAGATGACCCCCGGTTATTACTTACCATGCATTGCTGTGGTGTACAGATTGACCCGACGCTGAGCAAAGCCTACGCATTTCTTCTCAAGAGCATCTGCCCGGCCAACACCAGCCAGTT
CTTCCCGAACACGACGGTGTTCATGGACCTCATCACGCCGGAAAGGTTTGACAACAAGTACTACGTCGGCCTGACCAACAACCTGGGCCTCTTCAAGTCAGACGTGGCGCTGCTGACCAA
CGCGACGATGAAGGCCCTGGTCGACTCCTTCGTGCGCAGCGAGGCGACTTTCAGGACCAAGTTTGCCAGGTCCATGATCAAGATGGGGCAGATCGAGGTGCTGACGGGGACGCAGGGCGA
GATCAGGCGCAACTGCAGGGTCATCAACCCCGTTAGTGCCACCGATGATGTCGTCCTCGCCCGCCCATCAGGATTCACTGGAGTGGCTGCGAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGAAGCGGCACTGCTTGCGCTTCACCACCGTCCTGGCGACGACGCTTCTCTCCGCCACCGCCGCCTGCCTCGACGTCGGCTTCTACGACAGGACATGCCCCACTGCCGAG
ACCATCGTGCAGCAGACCGTGGCGGCCGCGTTCAGGAACAACTCCGGCGTCGCTCCGGCGCTGATCCGCATGCACTTCCATGACTGCTTTGTCAGG
GGCTGCGATGGCTCGGTGCTGATC
GACACGGTAGGCAACCTGACGGCGGAGAAGGACGCGCCACCCAACAACCCCAGCCTCCGGTTCTTCGACGTGGTCGACCGTGCCAAGGCGTCACTGGAGGCTCAGTGCCCCGGCGTGGTC
TCCTGCGCCGACGTGCTCGCCTTCGCGGCCAGGGACAGCGTCGTGCTCTCCGGTGGCCTCGGCTACCAGGTGCCGGCCGGACGCCGTGACGGGCGGATATCCAATGACACCGAAGCCCTC
AACAACCTGCCTCCGCCGTTCTTCAACGCCACCGAGCTGGCAGACAGGTTCGCCTCCAAGAACCTCACTATCGAGGACCTGGTCGTGCTCTCCGGCGCGCACACCATCGGCGTCTCGCAC
TGCAGCGGCTTCGCCGGCCCGACAGACCTGAACGGCCCCGTTGACCGGCTCTACAACTTCAGCTCGCCTGACGGG
ATTGACCCGACGCTGAGCAAAGCCTACGCATTTCTTCTCAAGAGC
ATCTGCCCGGCCAACACCAGCCAGTTCTTCCCGAACACGACGGTGTTCATGGACCTCATCACGCCGGAAAGGTTTGACAACAAGTACTACGTCGGCCTGACCAACAACCTGGGCCTCTTC
AAGTCAGACGTGGCGCTGCTGACCAACGCGACGATGAAGGCCCTGGTCGACTCCTTCGTGCGCAGCGAGGCGACTTTCAGGACCAAGTTTGCCAGGTCCATGATCAAGATGGGGCAGATC
GAGGTGCTGACGGGGACGCAGGGCGAGATCAGGCGCAACTGCAGGGTCATCAACCCCGTTAGTGCCACCGATGATGTCGTCCTCGCCCGCCCATCAGGATTCACTGGAGTGGCTGCGAGC
TAG

Retrieve as FASTA