Entry information : GmPrx89 (Glyma06g42850.1)
Entry ID 1948
Creation 2009-01-05 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx89 (Glyma06g42850.1)
Name (synonym) GmPrx89 (Glyma06g42850.1)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Etiolated seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx89
start..stop
S start..stop
GmPrx34 587 0 1..319 1..319
MtPrx57 505 0 8..319 6..317
PsPrx11 502 0 8..319 6..318
MtPrx97 501 0 7..319 5..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46156886..46157101 216 N° 2 46156101..46156292 192 N° 3 46153752..46154303 552  
complement(join(46153752..46154303,46156101..46156292,46156886..46157101))


exon

Literature and cross-references GmPrx89 (Glyma06g42850.1)
DNA ref. Phytozome 11:   Gm06 (46157101..46153752)
EST ref. GenBank:   BQ080657 [3' end]
Protein sequence: GmPrx89 (Glyma06g42850.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (294)
PWM (Da):   %s   33967.03 (31143.6) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.4 (8.40) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSLNSHFFVVVFILSLLAFSSNAQLSPTFYAKTCPNVQTIVSSAMRQAVAKEARIGASILRLFFHDCFVNGCDGSILLDDTATFTGEKNAGPNRNSARGFEVIDTIKTNVEASCNATVSCADILALATRDGIVLLGGPSWTVPLGRRDARTASQSAANNQIPGPSSDLSTLISMFASKGLTASDLTVLSGAHTIGQAQCQFFRTRIYNETNIDTNFAATRKTTCPATGGNTNLAPLETLTPTRFDNNYYADLVNRRGLLHSDQVLFNGGSQDSLVRSYSGNSAAFSKDFAAAMVKLGNISPLTGSSGEIRRNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 7 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTCTCTTAATAGCCACTTTTTTGTAGTAGTATTTATTCTTTCTCTCTTGGCCTTTTCTAGCAATGCACAACTATCTCCCACCTTCTATGCCAAAACTTGCCCCAATGTTCAA
ACCATAGTGAGCAGTGCAATGAGGCAAGCTGTTGCTAAAGAAGCCAGGATTGGTGCCTCTATTCTTCGTTTGTTCTTTCATGATTGCTTTGTAAAT
GTAAAGCCTCTAGCTAGCTACCCC
CCTCTTTGCATCTATGGCTCACAAAATTATTCTTAGTTACTGAATTAAGCTAATTAATAAGCTCACATTTTATTCCATATAATATATATAGGCTAGCTAGCTAGGATCAACTATGTCCAA
ATGGAAACCAAATTTACACTTTTACCCTCTGGATTTTCAATCTCAGACATATTCTTTTCTTTAAGTTTTTTTTTTATTGCATCATCTCAAAACTTTTGTTAGTTATCACATTAAAAGATG
GGTTTTCATTGTGAATTATTTTGTAATTTATAAACTACTATGACCTCAATTTAGCATATATGATATTAGAGTAAACTGCAATTTGTATGAGATCGAAGTAAGAAGTGAGAACATATATAG
CTTAGTTCCACCTCAAAAACCAGTTGAAGTTGTTAATTAACCTGAAGAAATTGTCCAAGTTATATATTATAAGTATTTAATTTTCAGTTCATAACTAGCCAATACTTGGCAATTTGTACA
AAGGGTTTTAAGTTCAATTAAGTTACAAAAAATTTAAGGTGGCCCAAAACAATTACATTTTTAATGTTAATTATTTCTTTTGTATGCAGGGTTGTGATGGATCAATCTTATTGGACGACA
CTGCCACATTCACTGGCGAGAAAAATGCAGGACCAAACAGAAATTCAGCGAGGGGCTTCGAAGTTATTGATACCATTAAAACCAACGTTGAAGCTTCTTGCAATGCCACCGTGTCGTGTG
CTGATATTCTAGCACTTGCCACAAGAGACGGAATTGTGCTG
GTGAGCCAATTCTCCATAATTTAATTATTTGGCAAACTCTTCATCTTTAATGAATGATGCATAGTGCATGTATCATCAG
TGCTAATAATACACTATCTAATATTTTTTTTAAAAATATTCTTTTATTATTGATTAAAATTTATCAGAATATGAGTGTGTTCTTAATTTTATAATTTCTACAAATTTGAATCAATGCTAA
AATGGGTCTAAAATACACTCAACTAGATATTTAATAAAGAGGCTTAAAAATGGGTCTAGATTATTTTTTAAATTTTTTTATAATAGGTCTTACAAGAAAAAGAAAGAGAAGGAATAAGGG
AATTAAAAAGGGGTTGAAGGCATTATTGGAGGTCAAATGTGCACATACATACTCACTCACGTTCCACAATTTTACTGACTTGAGGGGAATGAGTCTATGTTCTTTCCCGTACGTGTGGGG
AATTGAAGTAGATCTCTGTGGAAAAGTTAGGCCAAAGATTTTAGGGACATTGTAGATATTCTAATAAGAAGGGCATTTTAAGATTTATAAAACCTTAAAGTTTTAACATTGTGATGATCA
ATTACATTAAGTAGCTGACCAATTAGAATAATGTATTTAACATCACTAATTAGCGAATCACTTACCGTTACTATGGACTTAAAATTAAAATTAAAATTAAATATTTTTGTAAACATAAGA
TTAAATTAAAATAAAATATAAGCAGTAGTATGCAGGCTTTTTGCTTCTCCAATTGAGACTAGTGTGCTTTTCTCACTGAGATTATGACGTGAAGTCATTCTCACAATTCACAAAGTAGCT
AACTTGATGTTACTTATAATTATTTCCTTTTTCTTCGGCATGAGCCTATTTTCAAACCTTGTCCCCCACTTTCGGTTTCACTTTTCTGGCATAATCGACCATCATGCAATGTAGTGGGGC
CATCCAATAATATCACGCAAAACACACACATTGAACAGAATAATTAATAAAAAAACACATCAAGGTTCATGTGTCATGCCTATATCTTATCTCTTTATAAGGAAAATCCCACATTATCAT
CTCTACCAAAACAAATAAGATAAGAGAAATTTTATGATATCTAAGAAATTTAAAGATTTTGATATTGAAACTTTCTTTTCATCCATCTTTCTTGATGTCTTAAAACTCCTTCAACTATTA
ATCCAAATTAAAAGCACTTACACCATAATCCTTAAATTTCTCTAGGTAACATAACAACTCTTGTGTATGAATAAAAATGTGTATGAAAATTGATATTTCCACTTACATAATTGTAATGAT
AATAAATTTATTAATTTTTATTGTAATTATGTTAAAATCAATAAAAGAAATATAGCTGTTTGGCTGAGTGTCAAATCATGGATTCACATTCTTCCAATACGTTTTATTATTGTTTTTAGG
TTATTTTATAAAATTGACATTTTTTTTTTACAAAAACACTCTCACATACATGTTAACCAAACACACTGACCCACCCACCACAGTTTTTAATTGATTGACACCGTAAAACATGTTTGGATG
GGTGTTGGATCAAGTACATCCACGTTCTTCCAATGCATTTTACTATTGCTTCCTTGTCGTTTTATAAAATTAACATGATTTTTTTTTACAGAAATACAATTTCCATCAGTAAACCAAACA
GTTGATGTTTACAGGGACAATGACCATTTATAATTTTTAATTGGCTGACACTATAAACATTTTTAGTACATCAAAAATTAAGGTGACAACAACTATATATGTCTTGATGACTCAATTATT
ATCATTAATTTTTTAAGGCATGGTGATTTGCATTACAGCTAGGAGGACCCTCATGGACAGTTCCTCTAGGAAGAAGAGATGCAAGAACAGCAAGCCAGAGTGCAGCCAACAACCAAATCC
CAGGACCCTCCTCTGACCTCTCAACCCTAATCTCTATGTTTGCATCCAAAGGCCTAACAGCAAGTGACCTAACCGTTCTTTCAGGTGCCCACACAATAGGCCAAGCACAGTGCCAGTTCT
TTAGAACTCGCATATACAACGAAACCAACATCGACACCAACTTCGCCGCCACCAGAAAAACAACTTGCCCCGCCACCGGAGGGAACACCAACCTGGCCCCTCTGGAAACCCTAACCCCGA
CACGATTCGACAACAATTACTACGCCGACCTCGTCAACCGCCGTGGCCTTCTCCACTCCGACCAGGTGCTTTTCAATGGTGGGTCTCAGGATTCCCTTGTGCGGAGCTACAGTGGCAACA
GTGCTGCATTTTCTAAGGACTTTGCTGCTGCCATGGTGAAGTTGGGCAATATTAGTCCCCTCACTGGGTCCAGTGGGGAGATCAGAAGGAATTGCAGGGTTGTGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTCTCTTAATAGCCACTTTTTTGTAGTAGTATTTATTCTTTCTCTCTTGGCCTTTTCTAGCAATGCACAACTATCTCCCACCTTCTATGCCAAAACTTGCCCCAATGTTCAA
ACCATAGTGAGCAGTGCAATGAGGCAAGCTGTTGCTAAAGAAGCCAGGATTGGTGCCTCTATTCTTCGTTTGTTCTTTCATGATTGCTTTGTAAAT
GGTTGTGATGGATCAATCTTATTG
GACGACACTGCCACATTCACTGGCGAGAAAAATGCAGGACCAAACAGAAATTCAGCGAGGGGCTTCGAAGTTATTGATACCATTAAAACCAACGTTGAAGCTTCTTGCAATGCCACCGTG
TCGTGTGCTGATATTCTAGCACTTGCCACAAGAGACGGAATTGTGCTG
CTAGGAGGACCCTCATGGACAGTTCCTCTAGGAAGAAGAGATGCAAGAACAGCAAGCCAGAGTGCAGCCAAC
AACCAAATCCCAGGACCCTCCTCTGACCTCTCAACCCTAATCTCTATGTTTGCATCCAAAGGCCTAACAGCAAGTGACCTAACCGTTCTTTCAGGTGCCCACACAATAGGCCAAGCACAG
TGCCAGTTCTTTAGAACTCGCATATACAACGAAACCAACATCGACACCAACTTCGCCGCCACCAGAAAAACAACTTGCCCCGCCACCGGAGGGAACACCAACCTGGCCCCTCTGGAAACC
CTAACCCCGACACGATTCGACAACAATTACTACGCCGACCTCGTCAACCGCCGTGGCCTTCTCCACTCCGACCAGGTGCTTTTCAATGGTGGGTCTCAGGATTCCCTTGTGCGGAGCTAC
AGTGGCAACAGTGCTGCATTTTCTAAGGACTTTGCTGCTGCCATGGTGAAGTTGGGCAATATTAGTCCCCTCACTGGGTCCAGTGGGGAGATCAGAAGGAATTGCAGGGTTGTGAATTAA

Retrieve as FASTA