Entry information : GmAPx01 (apx1 / Glyma11g15680 / Glyma1_01-PACid_16284028 / Glyma1_01-PACid_16284032)
Entry ID 1954
Creation 2006-09-04 (Felipe Teixeira)
Last sequence changes 2014-11-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-06-26 (Christophe Dunand)
Peroxidase information: GmAPx01 (apx1 / Glyma11g15680 / Glyma1_01-PACid_16284028 / Glyma1_01-PACid_16284032)
Name (synonym) GmAPx01 (apx1 / Glyma11g15680 / Glyma1_01-PACid_16284028 / Glyma1_01-PACid_16284032)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation Cytosolic
Tissue types Flowers
Leaves
Roots
Stems
Inducers Pathogen interaction
Phytophthora infection
Salicylic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value GmAPx01
start..stop
S start..stop
VuAPx01 492 9e-180 1..250 1..250
MtAPx01 486 1e-177 1..250 1..250
GmAPx26 482 5e-176 1..246 1..246
PsAPx01 472 9e-172 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11352171..11352289 119 N° 2 11352395..11352569 175 N° 3 11352659..11352724 66 N° 4 11353287..11353335 49
N° 5 11353422..11353507 86 N° 6 11353637..11353716 80 N° 7 11353820..11353922 103 N° 8 11354009..11354067 59
N° 9 11354196..11354211 16  
join(11352171..11352289,11352395..11352569,11352659..11352724,11353287..11353335 ,11353422..11353507,11353637..11353716,11353820..11353922,11354009..11354067,113 54196..11354211)


exon

Literature and cross-references GmAPx01 (apx1 / Glyma11g15680 / Glyma1_01-PACid_16284028 / Glyma1_01-PACid_16284032)
Literature REFERENCE 1 Chatfield,M. and Dalton,D.A. (1993) Ascorbate peroxidase from soybean root nodules. Plant Physiol. 103 (2), 661-662.
REFERENCE 2 Wan J, Torres M, Ganapathy A, Thelen J, DaGue BB, Mooney B, Xu D, Stacey G. Proteomic analysis of soybean root hairs after infection by Bradyrhizobium japonicum MPMI. 2005 18(5):458-67.
Protein ref. UniProtKB:   Q43758
DNA ref. Phytozome 11:   Gm11 (11352171..11354211)
Cluster/Prediction ref. UniGene:   Gma.13160
Protein sequence: GmAPx01 (apx1 / Glyma11g15680 / Glyma1_01-PACid_16284028 / Glyma1_01-PACid_16284032)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   26963.73  
PI (pH):   %s   5.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSADYQKAVEKAKKKLRGFIAEKRCAPLMLRLAWHSAGTFDKGTKTGGPFGTIKHPAELAHSANNGLDIAVRLLEPLKAEFPILSYADFYLAGVVAVEVTGGPEVPFHPGREDKPEPPPEGRLPDATKGSDHLRDVFGKAMGLTDQDIVALSGGHTGAAHKERSGFEGPWTSNPLIFDNSYFTELLSGEKEGLLQLPSDKALLSDPVFRPLVDKYADEDAFFADYAEAHQKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic, 3 cDNAs and 321 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGTCTTACCCAACTGTGAGTGCTGATTACCAGAAGGCCGTTGAGAAGGCGAAGAAGAAGCTCAGAGGCTTCATCGCTGAGAAGAGATGCGCTCCTCTAATGCTCCGTTTGGCG
TACGTTCTTTTTTTTTTTCTTTCTATTTAACATTAGATCACTGTTATTTACGATTGAGTTTATGGATTGTCGTTTTGACGCGTTTTGGTGCGTTTCGTGTGCAGATGGCACTCTGCTGGA
ACCTTTGACAAGGGCACGAAGACCGGTGGACCCTTCGGAACCATCAAGCACCCTGCCGAACTGGCTCACAGCGCTAACAACGGTCTTGACATCGCTGTTAGGCTTTTGGAGCCACTCAAG
GCGGAGTTCCCTATTTTGAGCTACGCCGATTTCTACCAG
GTGATGATTTTTTTTTTGTTAGATCTGAGAAATTGTTGTTTCTTGTCTTTGGTGTTTGTACGCTTAATGCTGTGTTTGTGT
TGACGCAGTTGGCTGGCGTTGTTGCCGTTGAGGTCACGGGTGGACCTGAAGTTCCATTCCACCCTGGAAGAGAGGTATAATATCGCAAGTTTTTAGTTCCAACTGTTGTTCTCTGTTATT
TGATTTGATTATGCATTAATGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCTGATTATCTATTTTTTTGTAAACCGATTTGTTTGTATTTTTTTTTTGCTGAATTT
TGATTTGCTCGTAGTGTAAACGGTAGTTGTCGTAGACCTATTGAATTACGAATTTGGATTCGGATTCCCTGCATTCAATTTTATTCACGTCTCCTTGAATTACTAGGATTACATTCTAGT
CGTTTAAATCAACTCTTCTTACCGTAGCACATTTGGTAGAATGTTTTCCACAAAATTCCTTTTATGGCAAAAACTCGCAATTTAATTATTATAATTTTTTACTGCATCTTTAGTTAATTT
GGATGCTTTGCATCATATTTTGTTGTTTGTATTGTTATTTTGTACCCAGAATTTTTAGTAAATTACAGTGATCTATTTTTGGGGTCGTATACTATTTTTGTGCGGGTAATGTTATTGTTT
TTTTGGAGGCTAATGTGGTGTTTTCCTTCTGATTAGGACAAGCCTGAGCCACCACCAGAGGGTCGCTTGCCCGATGCCACTAAGGGTCAGTAGTCTAAATTTGTATTGTCAAGAAATGTT
TGTGATTGATAGTGTTTGTTTTGCTTAGGGTTTCGTTCCTGATTGTTGCAGGTTCTGACCATTTGAGAGATGTGTTTGGCAAAGCTATGGGGCTTACTGACCAAGATATCGTTGCTCTAT
CTGGGGGTCACACTATT
GTATGTTATGATTTTGAATTTGTTGTTTTAGCCACATTGCAAAATTATGCTGCTATTATATTGAGAAAAAATGTCACATCTAAACTTTTGTACCACTACTGGT
GTAATTTTGCCAAATGTATTTTGTAGGGAGCTGCACACAAGGAGCGTTCTGGATTTGAGGGTCCCTGGACCTCTAATCCTCTTATTTTCGACAACTCATACTTCACGTGGGTATTTTCAC
GTATCCAGCACGGCCTTTTGAACACTCTTCTTCTTCTTTACTATTTGAAATTTCCGTTCTAATTTTTTATCTGTCCTAAATTTTTTTAGGGAGTTGTTGAGTGGTGAGAAGGAAGGTCTC
CTTCAGCTACCTTCTGACAAGGCTCTTTTGTCTGACCCTGTATTCCGCCCTCTCGTTGATAAATATGCAGCG
GTATGTGTATTCTCTTAATTTTTCGCATAACATTGATTTTTTGAATGT
TGAACATTTAGTGATGTTTGATTTGCTAATGATTTCAGGACGAAGATGCCTTCTTTGCTGATTACGCTGAGGCTCACCAAAAGCTTTCCGAGCTTGGGTAAGTATTGATATTTCATACAT
TTTAATTTATAACTATGATTTTATGAAGCTTTTCTCTTAGTTTTACTTGACACGTTTTACGTCGTTAATTGGGTTCTGATTCGTGTCATGAATATGTTACCTCAGGTTTGCTGATGCCTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGTCTTACCCAACTGTGAGTGCTGATTACCAGAAGGCCGTTGAGAAGGCGAAGAAGAAGCTCAGAGGCTTCATCGCTGAGAAGAGATGCGCTCCTCTAATGCTCCGTTTGGCA
TGGCACTCTGCTGGAACCTTTGACAAGGGCACGAAGACCGGTGGACCCTTCGGAACCATCAAGCACCCTGCCGAACTGGCTCACAGCGCTAACAACGGTCTTGACATCGCTGTTAGGCTT
TTGGAGCCACTCAAGGCGGAGTTCCCTATTTTGAGCTACGCCGATTTCTACCAG
TTGGCTGGCGTTGTTGCCGTTGAGGTCACGGGTGGACCTGAAGTTCCATTCCACCCTGGAAGAGAG
GACAAGCCTGAGCCACCACCAGAGGGTCGCTTGCCCGATGCCACTAAGGGTTCTGACCATTTGAGAGATGTGTTTGGCAAAGCTATGGGGCTTACTGACCAAGATATCGTTGCTCTATCT
GGGGGTCACACTATT
GGAGCTGCACACAAGGAGCGTTCTGGATTTGAGGGTCCCTGGACCTCTAATCCTCTTATTTTCGACAACTCATACTTCACGGAGTTGTTGAGTGGTGAGAAGGAA
GGTCTCCTTCAGCTACCTTCTGACAAGGCTCTTTTGTCTGACCCTGTATTCCGCCCTCTCGTTGATAAATATGCAGCG
GACGAAGATGCCTTCTTTGCTGATTACGCTGAGGCTCACCAA
AAGCTTTCCGAGCTTGG
GTTTGCTGATGCCTAA

Retrieve as FASTA