Entry information : CreAPx02 (Cre02.g087700.t1.1)
Entry ID 1958
Creation 2006-01-18 (Christophe Dunand)
Last sequence changes 2006-01-18
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-20 (Christophe Dunand)
Peroxidase information: CreAPx02 (Cre02.g087700.t1.1)
Name (synonym) CreAPx02 (Cre02.g087700.t1.1)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Chlorophyta Chlorophyceae Chlamydomonadaceae Chlamydomonas
Organism Chlamydomonas reinhardtii    [TaxId: 3055 ]
Cellular localisation Stromal
Tissue type N/D
Inducer Stress treatment
Repressor N/D
Best BLASTp hits
Perox score E-value CreAPx02
start..stop
S start..stop
VcaAPx03 546 0 9..326 10..326
RobtAPx04 379 2e-132 29..327 1..274
SsAPx04_AU1 377 2e-130 18..327 68..352
NhyAPx05 374 7e-129 33..327 123..392
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1777541..1777691 151 N° 2 1777232..1777287 56 N° 3 1776976..1777057 82 N° 4 1776714..1776814 101
N° 5 1776410..1776497 88 N° 6 1776120..1776205 86 N° 7 1775908..1775971 64 N° 8 1775528..1775685 158
N° 9 1774894..1774967 74 N° 10 1774462..1774585 124  
complement(join(1774462..1774585,1774894..1774967,1775528..1775685,1775908..1775 971,1776120..1776205,1776410..1776497,1776714..1776814,1776976..1777057,1777232. .1777287,1777541..1777691))


exon

Literature and cross-references CreAPx02 (Cre02.g087700.t1.1)
Literature Leisinger,U., Zehnder,A.J.B. and Eggen,R.I.L. Isolation and characterisation of an ascorbate peroxidase gene from Chlamydomonas reinhardtii.
Protein ref. UniProtKB:   O49822
DNA ref. Phytozome 11:   chromosome_2 (1777691..1774462)
Cluster/Prediction ref. UniGene:   Cre.5409
Protein sequence: CreAPx02 (Cre02.g087700.t1.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   35525.89  
PI (pH):   %s   8.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQSARVSRTARHTRPSCRPQRAVAVRVSAKVNVEQLKALKAELYNYINSRGCNPISVRLGWHDSGTYDNIAEFPARGGANGSIRFKPEIDHGANKGLAIALAILNPIKKKYPDVSYADLFQMASATAIASGGPKIPMRYGRKDAKGPEECSPDGRLPGAAHPFADGSGSPAEHLRRVFYRMGLNDDIVVLSGGHTLGRARPERSGFGAEKTKYTDVGPGTSTASPSGATDRPVTPKPVGQQGTSWTVNWLEFDNSYFKIKAKRDSDLLVLPTDACIFEDDQFRPYAEKYAADQAAFFADYCVSHQKLSELGVEWEEGAPVTLD

Retrieve as FASTA  
Remarks Complete sequence from genomic, 1 cDNA (AJ223325) and 18 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGCGCTCGGGTTTCGCGGACTGCACGCCACACCCGGCCGAGCTGCCGGCCCCAGCGGGCAGTGGCCGTGCGTGTTAGTGCAAAGGTCAATGTTGAGCAGCTGAAGGCGCTGAAG
GCGGAGCTCTACAACTACATCAACAGCCGGG
GTAGGATCGACATGGTGCACTGTTCGCACAAAGCCACGCAAGCTCTCGAGTAGCATGATGCAAGTGAACAGTGCTCCACATGCTCTAGG
CCTGCCTACCTCGCATGCGTTTAGCCTGCAGTCAATTCTGAAGCTATCCCGGGAGTCCCAAACCCCAGAGCTCCCCTCCATTCCCGTGCTACGGTGCCACTCGCAGCCAGCAGCTTGGGC
CAATTATCGCTATGTGCTTTGTGTCTGTCGACTGGAATGCGCAGGCTGCAACCCCATTTCTGTGCGCCTGGGCTGGCACGATTCCGGCACCTACGACAAGGTGCGGCACTCGGGTGTTCG
CCCCGCGTCATTCAGGACGCGCAGTGCCTGCATGCACACGTGTGTGCGCACGTGCGAATTACACGGCGCATAGAGCTGCAGCCCACTGCAATCTACGTGAGCTGTAGATAACGGCGGTGG
CAACTTAAGGGTTAACGGACCTTGTCACCTGCAGAACATCGCTGAGTTCCCGGCCCGTGGCGGCGCCAACGGCAGCATTCGCTTCAAGCCGGAGATTGACCATGGCGCCAACAAGGGTGC
GGAAGGGGCTGTTATTGAATGGCGCTGGAGGCGCGGGGCCGCAGCGAGCAAGTAAACAGCACAGCAGGCGACACACGCAACCAGCAGTGTAGAAGCATCATGCTCAGCTCTAAACTTGCA
TGTGCTTCTCCTGGTCAATGATGCTAATGCTTTTCAGGTCTGGCTATTGCTCTGGCCATTCTGAACCCCATCAAAAAGAAGTACCCGGACGTGTCGTACGCCGACCTGTTCCAAATGGCA
TCAGCCACCGCCATCGAG
GTGTGTGTGCGGCGGAGTGTGGTGCGACGCGAACGACTGATGAAAGGCTAAGGAGCTGGCGCATGAGCTCATTGCTTCCCATTGGTGCCGTACTGCGGACCG
CTACTGCATTGTTGTCTGGGAGGAAGGCGTTTCTGCCTTCATGCAAGCCGCCATCGCGCAAACGCCCACACGCGGCCACTCCCCACCGCATTTCATTTCGCCACCACGCCTCAGGCCTCC
GGTGGCCCCAAGATCCCCATGCGCTACGGCCGCAAGGATGCCAAGGGTCCCGAGGAGTGCTCGCCCGATGGCCGCCTGCCGG
GTGCGTGGGGATTGGGTTCGGCTAATTGGGGGAGTGCT
GGCCGGAGGTTGTTGTGTGGGAGGCTGAATGGGTGGGACAACATGACCAGCATCACCGAGAAGCGCGAAAAGCGGGCCGCGGTTTGCCACTGGCAGGGGAGGTGTGATGGCGCGTGAGGC
GGGCTGTGGAACGACGCATCTCTTGCGATTTGCATCCGCACCGCAGGCGCCGCGCACCCGTTCGCTGACGGCAGCGGCAGCCCTGCGGAGCACCTGCGCCGGGTGTTCTACCGCATGGGT
CTCAACGACCAG
GTGTGTGGCGGGAACCGGTCAGTGCAGAGTAGAGGGGGCCAAGACCGTCCGTGCGATAATGGGGCAGGGGTGCGCTCACCAGGCATGCTACGTCGTTAACTCCACGAC
CCATCCCGACATGCCGGCATTCGCATACACCACTCCGCAGGACATTGTGGTGCTGAGTGGCGGCCACACCCTGGGCCGCGCCCGCCCTGAGCGCTCCGGCTTCGGTGAGTTTGCATCACC
GCTTGCAACATTCTCCCCCTTGCAACCAACCCACAAGCACCTGCGGATCCGCCCGGCCATTAGGCGCTCCCCCGACATCCTTCTACACTGCTTCTCCTACTACAAACGGCGTACAATTCC
TTCTGCCCACTGTCGCACTTCCCGTACCCCAGAATCGTCATCTTACGCCCGCTGTTTCCGTGTCCTCGAATAAATCTCCCCCGCAGGAGCTGAGAAGACCAAGTACACAGACGTGGGCCC
GGGCACCTCCACCGCCTCGCCCAGCGGCGCCACCGACCGCCCCGTCACGCCCAAGCCGGTTGGGCAGCAGGGCACCAGCTGGACCGTCAACTGGCTCGAGTTCGACAACTCCTACTTCAA
GGAG
GTGCGTGGGTGGGCAGGCGTGTGAAATACACCTGCAGTGAAATACACCTGCAGAACACCTGGGTGGAACACGTGTTTTGTGTGTATGTGTGCGTGTGTGTTAAACAAAACCAAACG
GAACAATTTCCGCCATACACGCGCGCGCAGTTACCCACAAATACCTACGCCAGTAACCGAGCCCCGCGTTTGTCGATGTTGCCCCAGTTGTCACCTTGAGTATACTCACCTGCACATGTT
GCCTGGAACCCCCTACCCGGGCGTTTGGCATTCAGCCTCGTCTCCAAGGTGCACCATCATGCGCTGCCATGCTCCGCGTCGGCGACGCGCTACAACGTTTACCGGGCACGCCTAATCCCC
TGGGGCTCGTCCACGGTCCATAGCCAGTCTGACCTATAACCGAAAACCGTGTTTCTGTGTGGGTCTGTCCAGGAAGTGAGGCGGGGGCGGAGGCGCGCGGCGTTTGGTGTAATCTTGGGC
GGCCCTCCGGCTGGCTGCCGCCAGGCCTTCTCCGCCACACCGCCTTGACGCCTCCTTTCCCTCCTTCCCACTCCTTCCCAACAGATCAAGGCCAAGCGGGACTCGGACCTGTTGGTGCTG
CCCACAGACGCATGCATCTTCGAGGACGATCAGTTCCG
GTGAGTTAGTGGGGAGGAGGAGGACTGGAGGAGGAGGATGGGATTTGTGTTCCGGCTGTGGAGGTTTGGGGTTTGAGGTAGG
ACGAGCGCACGAGTGCCAGCAGCAGCTTCGCTGCGCGGTGCGTGGGGACCGGCGCGGTCAGCACAAGGGCAAAGCGGCGACACCCGCCCGCCTGAAGCAACACTGCCAAGCTTGCGCGTC
CGCTGACCACGAACCGCATCGCAAGCGACCGCCCGCCCCGTCCCGCATGCTTCGCCGCTCACATGCTGCTGCTCCCCACGTGCCTTTTCCTGCCTTGCCCTCGCAGCCCCTATGCTGAGA
AGTACGCGGCCGACCAGGCGGCCTTCTTCGCCGACTACTGCGTCAGCCACCAGAAGCTGTCGGAGCTGGGAGTGGAGTGGGAGGAGGGCGCGCCCGTTACTCTGGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGCGCTCGGGTTTCGCGGACTGCACGCCACACCCGGCCGAGCTGCCGGCCCCAGCGGGCAGTGGCCGTGCGTGTTAGTGCAAAGGTCAATGTTGAGCAGCTGAAGGCGCTGAAG
GCGGAGCTCTACAACTACATCAACAGCCGGG
GCTGCAACCCCATTTCTGTGCGCCTGGGCTGGCACGATTCCGGCACCTACGACAAGAACATCGCTGAGTTCCCGGCCCGTGGCGGCGCC
AACGGCAGCATTCGCTTCAAGCCGGAGATTGACCATGGCGCCAACAAGG
GTCTGGCTATTGCTCTGGCCATTCTGAACCCCATCAAAAAGAAGTACCCGGACGTGTCGTACGCCGACCTG
TTCCAAATGGCATCAGCCACCGCCATCGAG
GCCTCCGGTGGCCCCAAGATCCCCATGCGCTACGGCCGCAAGGATGCCAAGGGTCCCGAGGAGTGCTCGCCCGATGGCCGCCTGCCGGGC
GCCGCGCACCCGTTCGCTGACGGCAGCGGCAGCCCTGCGGAGCACCTGCGCCGGGTGTTCTACCGCATGGGTCTCAACGACCAG
GACATTGTGGTGCTGAGTGGCGGCCACACCCTGGGC
CGCGCCCGCCCTGAGCGCTCCGGCTTCG
GAGCTGAGAAGACCAAGTACACAGACGTGGGCCCGGGCACCTCCACCGCCTCGCCCAGCGGCGCCACCGACCGCCCCGTCACGCCCAAGCCG
GTTGGGCAGCAGGGCACCAGCTGGACCGTCAACTGGCTCGAGTTCGACAACTCCTACTTCAAGGAG
ATCAAGGCCAAGCGGGACTCGGACCTGTTGGTGCTGCCCACAGACGCATGCATC
TTCGAGGACGATCAGTTCCG
CCCCTATGCTGAGAAGTACGCGGCCGACCAGGCGGCCTTCTTCGCCGACTACTGCGTCAGCCACCAGAAGCTGTCGGAGCTGGGAGTGGAGTGGGAGGAG
GGCGCGCCCGTTACTCTGGACTGA

Retrieve as FASTA