Entry information : AtPrx32 (At3g32980 / Atprxr3ge / AtP16)
Entry ID 198
Creation 2006-04-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx32 (At3g32980 / Atprxr3ge / AtP16)
Name (synonym) AtPrx32 (At3g32980 / Atprxr3ge / AtP16)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Etiolated hypocotyls
Flowers
Mixed tissues
Roots
Rosettes
Seedling shoots
Inducers Cold stress
Dark growth
Hormon treatment
Stress treatment
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx32
start..stop
S start..stop
AhalPrx29 702 0 1..352 1..352
BstrPrx67 696 0 1..352 1..352
CrubPrx101 687 0 1..352 21..372
AlyPrx32 665 0 1..352 1..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13529722..13529949 228 N° 2 13527616..13527807 192 N° 3 13526947..13527115 169 N° 4 13526404..13526873 470
complement(join(13526404..13526873,13526947..13527115,13527616..13527807,1352972 2..13529949))


exon

Literature and cross-references AtPrx32 (At3g32980 / Atprxr3ge / AtP16)
Protein ref. UniProtKB:   Q9LHB9
DNA ref. Phytozome 11:   Chr3 (13529949..13526404)
mRNA ref. GenBank:   NM_180321
Cluster/Prediction ref. Phytozome Gene 11:   19659045 UniGene:   At.47588
Omic ref. ePlant:   At3g32980 TAIR:   At3g32980
Protein sequence: AtPrx32 (At3g32980 / Atprxr3ge / AtP16)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (323)
PWM (Da):   %s   38691.39 (35558.9)  
PI (pH):   %s   6.65 (6.50) Peptide Signal:   %s   cut: 30 range:30-352
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNFSYSSLSTWTTLMTLGCLLLHSSISSAQLTPTFYDNTCPSVFTIVRDTIVNELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAAPNANSARGFPVIDRMKAAVETACPRTVSCADILTIAAQQAVNLAGGPSWRVPLGRRDSLQAFFALANTNLPAPFFTLPQLKASFQNVGLDRPSDLVALSGGHTFGKNQCQFIMDRLYNFSNTGLPDPTLNTTYLQTLRGQCPRNGNQTVLVDFDLRTPTVFDNKYYVNLKELKGLIQTDQELFSSPNATDTIPLVREYADGTQKFFNAFVEAMNRMGNITPLTGTQGQIRQNCRVVNSNSLLHDVVEIVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns), 7 cDNA and 232 ESTs (168 from roots), Also identified by proteomic (Feiz, 2004).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAGAAGAGA GAGAACTAAT TTCGTTATTA CGGTTCTCAG ATCTTCTAAT ATATTGTCTT CTATAGATAA ATATTTTGTT CATCCTAATA GTTTCATCAA GAATCCAAAG TCAATTGCTC  ATTATTCCAC GAAATCTAAG GGGCAGCTAG AAACAAAGAA AATATGCTAA CGTGAAGAAG GCGAAAACTT GTCATTTTGA CGTTATAATA GAAATTCAAT TTTCCATCGC CGGGAAAAGA  GGAAATGTAC AAAAATAAAT AAATAAAAAA TTTGAAACCG TTCACCTAAT TAGATAGCTA ATTGAAATTT AACAATAGTT TAAGCTGTCT TTCTGGACTC CATTCTTAAT TGACTTATTA  TAGTTTTGAG CTTTAAGAAG AAAAAAAACA CTACTTACAA ATGCACTATT TTAGATACGT GTTATATGTA CCAAAGAAAA TTGCGACGAT ATTTGTTTAG TCGCAAATAT TAACAACTAT  TTTAAGACCG TTGAGTGACT ATCCACGGCC ACGGTGCATA CATAGAATCG GAAAAAAGTT TCATATTAAC AACCATTTTG ATGCATATTT TAGATACTCT ATATATCGTC AGTGACACAT  TATATAATTT ATACATCTTG AAACATAATA TAAATTTAAA CAAAATAAAT TGGTTAAAAC TTTTGTTTTC GAATTAAGTT GTGTTTAATG AATGATAGTG GTTTCATTTG CTCATTTTAT  ATATAGATTT ACTGTTTTCA AGATATCTTA TAAAAAAACA TTTATATCAA AAAATTTATA AACTTAAAAG TTTGTTTTTT TTTGTCAAAG AGAATCTCCA AAAAAAAACT AAAGAAACCT  ATCTACCATG TAAGGACCGG ATTTTAAAAT TTAGGCATTA AATATTTTTA TACCGAACCG GACCAAATAT ATTTGGTTTT AAGAGTTTTT AGCAAGATCG AACTAAGTTA CCCCGATTGA  CAAGTCTACT TATTTGCAAG AAAATAAAGA AACTTTTTTT ATTTGTCATC TCAATAACTT ATATATAACA TATAAAAAAT TAGCGATTTA TTTAATCCCT AAAAAAGTAA CTTTAATATA  TATTTTCAAA AAAGAAATTT TAACGAATAA AACAATTTAG ATAAGAAAGA ATTTGTCTCT TCGATAAGTA AGTTATATTT GAAGACAAAA AGTTTAGTTG CACGAAGCGT TAAGAATGTT  TTATAAAAAA ATCTTAAAAC TATTATACTG AAACCACATT TATATAATCA CGATTTAAAT TGGGTTCTAG ATGATTTGTG ATTCTTTTTA TTTTGTAACC ACACTTGTTG TTGTTTGATA  TTCTTGTTCC GTTGCTAGAA GTTGGACTCT AAAATATATT CATGTTAAAG CATATACAAT ATATTTTTAT ATTTATTTTC CACACTTCCA TTTTGCTAAT TTCAATTTTA GTTTTAATTT  AGTGAGTCAA ATATTTTTCA ATTATCTATG AAATTCAAAG ATACATTTCG AAAGATGATT TTAATTATGT TATCTCATCA ATTATATTCA TAACTATAAT TATATATTTT AGGTGTACAG  AAATAAATCA CTAATCGATG CATGTAAATG TTGATGTATA TGAATGTAGG CATTATGAAA TTCTTACTAA TATTTATGTC GTTAATTAAT GTTTGGATTT ATGTAGACAG CATACGTCCT  ATAAACCAAG AGATGATTCA TCCTTTTTAT CATCCGGAAT TCGGGATCTA TTAATATTGT TTAGTGTTAA TATACAATTA AAAAAAAAGT TAGTGGTGAT ATACAGTGTA TACATTATTT  TTTGAATGAA ATTTTACAGT GTAGGTTATT AAAAATAATT ATTAGAAATA GCTGTTGTTA AAAATAAAAA TATAACAATA GAATTAGTTC ACAAAATGTT ATGGACCCAT TCGGTCATTC 
CCCTATAAAA GGATCCTTGA AGATATAGAG TTTCCTCATC TTCTCAAACT AAATCAATTA AAGAGGTTTC TTCTTATAGA A 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CATAACGTTG TCTCGATATA TGTGGCAACC AAAAATATGT TTTATGAAAT AAAGTGTTCT CAAAATGTTT ATGAAGAACA TTTCGTCTTA AATCTTTTCT GTCCTTCATG TTTTTCTTAT  TACTTTTTCA AAGTAATCTA TCTACCCTCG ATTGATGGAA AATAGAACTG AAACGAATAG CATGGTTAAT TTACTTAAGA AATAATATGT AGTGTTTTTT TTTATATTTG TGAATCTAAA  TATTTTAATG TTTACTATTC AAGAAATTTT AGATCTTTTT AGATTTTAAT GGATGATTGT TTGGATTATT TTCTCTTTTG TTTTGAAATC TTGATGTTAC TATTATCCAT GTATAAATAC  AGTACTTCCA CTATATTTGA CAACAACAAA ACGTTATATA GATAAAATTA TTTAAAACTG TGCATTATAA AGGAAATTAT TATTAATTCA AGTATTATTT TAGAATTACA AATATTCATT  TATATTTACC GTTATAACTA AATAAATTTT CTTATCAATA TAATTTCAGA CGTTTCACAT GTTATACGCA GAATTTAACA TTTTTACGTA ATTTTTTCTT ATAACCAGAA ATAATATTAT  AAAATTCCTT TTTAACTACA TACGATGTTT AATTATGTTC TAAGTATTTA AGTTATTCGC AATACATTGT TGTTGTTTAT ATTAGTTGAT ACGAAAATGA ATTGATGGAG GCTTAGTTAA  TTAGTTTTCA AGTTCAAAGG ACTTATATCT CTTAAAGGTG GGACCCACAC CATGTTGAAT TCATCTACTT TGGAGCGGAG ATCCCTCTCA ATCGGGCGTC GAAGCCAACA CTTCACTTGG  AAGATTTAAT ATTGGGCCAA TACCACGTTG GTGATATTTG ATTAGTCTCT TTGCCTTATC TTGCTTTTTA AGATTTATGT TCAATTTGTA TCCAGCATGT GAGGAGCTAT CTAGATAGTG 
AACGCAACAA ATAGAGTCTT AGTCTACATT TGATCCTAAG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTTCTCTTATTCTTCCTTGTCAACTTGGACAACCCTAATGACATTGGGTTGTCTTCTGCTTCATTCATCCATTTCCAGTGCTCAGCTAACCCCAACTTTCTATGACAATACATGT
CCAAGCGTCTTTACCATCGTACGGGATACCATAGTAAACGAGCTAAGATCGGATCCTCGTATCGCTGCAAGCATCCTTCGTCTTCACTTCCACGACTGTTTCGTCAAT
GTAAGATATTAA
TTTTTCACCTTTTATGTTTTGGATATACAATTTGAAATACCTTTTCGTTTGAAATTGTATATGTCAGTATCTTTTACAATAACGTCCTTTAACGAAAGAAAGAAAAATCTTTTATAATTA
CATCAAAGACTCCCTTTTCAAATTTTTATAGTTACGTTAGTATTCGTTCTAACTATTTGTGTTATCAAGTTACTCTAATTTTCAGATTTGATAGGCTTGTAGTTATGATAATTGATTTCT
GATAAATATGGGATAATAGCGCCACTCAAGAAAAACCAGTTACGTCTTTGTCAGTTTTAAATAACACATGGTTTGTTGATAACTACAAAATGGAAACACGTGGTTTAGGGCTTTAGTATT
TACATAAATTATTATGGGAAAAAAATCAGAATGACCCAAAATTAATGGTTTAATTACTAAACTATCTCATAAATTGTAAAGGTTAATTGTGTTACAATTATGCTTTTAAAAAACTTTTTT
TTATATAGAAATTCTTTAAATATCTTTTATATGAATGACAAAAGTCAAAAATATATTTCAAAACTTTTCCATCGTAGAAAAATATTTTCCAAAAAAAAACTACAATGAAAAAAGTATGTG
GATCTACTTGTTATAAATTTATATATTTTCTACCACAAACTCATTTGCTGCGATATATCTATTTTGTGAGACTATTTTGTCCCACAGACTTTTATAATTTTGATAGATTTATTATAGTAC
GTGACATATTTTTTTTTAATAGTAATGTTATACTTATTATTTTTGACATAAATCTGCCATATGGTAAAAGATTTGTCTAATATAAAATAATATAATGATTAGAATGATGTTTAGTTATAA
CAGATTTGTTTTAGGTGATATATTTCTTTAATAATAACAAAAATATGACGTTTAATGACAATCTTTTATATTTGAATCCAATGATGATAGATTTATAGTTGCCACTGGCAAATTTTTAAA
TATAAGTTTGTTCAATGGTTACAGATTTTAATTGATAGATTCCTATTGAAACTTCAATATCATTTTACCAAACGCTTAAATTTTGTGGCTTAATATTTTAGGTTATGAGAGATTTGTTTC
AAAATCAGGGTTAAGCTTATTACGACAGATTTATCTTCTTTTTTTTTTAATTATTTAGAAAAACAAAAATGGGTTTTTGGTCTTTTGCTTCAATATTGGGACATGTTAAGTTTCTTCTAC
CTTTAGGTGTTAGTCTAGTTATTTTTGTTTAAATTTGGATCCAACTAGATAAATCTCAGTTTTATTAATTAGACCAATATTTATATGTTACCACACTTATAGGTCACTGGGCTAATTAAC
CACTCTGGTATATATATATCAATATAAAATTTACGGTAGTTAGACGTGATATTTTTGTTTTTTACTATCGAGTATCTTAGCTCTTGTCGTCAAATATGACTCATGCCTTTTAAAAAAATG
ATTTCACAACATTTAGTATAATTTGATCTCCCATTCAACGAACGTAAATTATCCGTATAATAATTTAAGAAAAGCATGGACCCGTACTGTACCAAACACGTTAGGAGTTTATATCAATCA
TTTATTGAATGTTACAAAATAACATATTAACATATTATATAAATCGTGTATTATTTATGGGAAGTTGATCAGATCGATGTAGTTGTTAACCTAAAACATAATGTTGAATTTATGCGTTAG
AAGATTAATATAATGTAAACTAAAATGTATACTAACTTGTTTACACTATATCACCACGCGTTGCTTAAAAAGAACAAACCTTTTTATTGAATGAAAATGCAATCTAACACTTTTTGTAGG
TATACTAAATATGTCATCATGAAAAGAAAAAACTATATATCATTATGATTTCAATATATGTTGACTAATTAATTAGTGAACACATAATTTTTGTTTGTATAGGGCTGTGATGCATCGATC
CTGTTAGACAACACAACATCCTTTCGAACAGAGAAAGATGCGGCTCCAAACGCAAACTCGGCTCGAGGATTTCCAGTGATCGATAGAATGAAAGCAGCAGTAGAGACAGCATGTCCAAGG
ACTGTTTCATGCGCAGATATACTTACCATCGCAGCTCAACAAGCTGTAAATTTG
GTATGCACCATTAATTTATCTCTCTTTTTTCATTTATTATAAACATTGTCTCAAATTATTCTGTTT
AGTCGTCACGGATAACATATTAAAACATGACAACATACTATTAAAAATAAATATATGGACTGCTGAAGGTTGGAAGTTGTACCATTTAGATTTAATCAATAGTTATAAAAAGGCTATCTA
CTATACCAGACATGTCTTTAAGATTAATTGTGAAAAATATTTAAAACGCATAGTGGATTGGTAATAATATCAAGTCTCATTACAATAACAAATTTCAATACAATAATAATATCAAGTCTC
CTTTTTTGGTAACTAAAAAGAATAGAATCATATTTTCTAAAATTTTGAAAAAATCCATGCATAACTTTGAGAATCTACTTGTTTAAAATTTATACTATACATTTGTCTTTTTGGTTTTGT
TCATAGTAAGACTTCGACATGGTAAGAATTACTTTCGTAAACAAATAATTGTTTTCTAAATATAAATGTTTTAGGCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGAAGAGATAGCT
TACAAGCATTCTTTGCTCTCGCTAATACAAATCTTCCCGCTCCATTCTTCACTCTCCCACAACTTAAGGCCAGTTTTCAAAATGTTGGACTTGACCGTCCCTCTGATCTCGTTGCACTCT
CTG
GTAATAAATTATTACGAGATATATTAAATAAGTTTAAATACTTTATTGTTAACGTATCGCTTATTTTGGTTAGGTGGTCACACATTTGGTAAAAACCAGTGCCAATTTATTATGGAT
AGACTATACAACTTTAGCAACACTGGTTTACCCGACCCTACTCTTAATACTACATACCTCCAGACACTTCGTGGACAATGTCCCCGCAATGGTAACCAGACCGTCTTAGTTGATTTCGAT
CTACGCACACCGACGGTTTTTGACAATAAATACTATGTGAATCTGAAAGAGCTAAAGGGACTTATCCAGACGGATCAAGAGTTGTTTTCCAGCCCTAATGCCACTGACACAATCCCCTTG
GTGAGAGAATACGCTGATGGCACTCAAAAATTCTTCAATGCTTTTGTGGAAGCAATGAATAGAATGGGAAACATTACACCTCTCACTGGAACTCAAGGACAAATCAGACAGAATTGTAGG
GTGGTTAACTCCAACTCGCTGCTACATGATGTGGTCGAAATCGTTGACTTTGTCAGCTCTATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTTCTCTTATTCTTCCTTGTCAACTTGGACAACCCTAATGACATTGGGTTGTCTTCTGCTTCATTCATCCATTTCCAGTGCTCAGCTAACCCCAACTTTCTATGACAATACATGT
CCAAGCGTCTTTACCATCGTACGGGATACCATAGTAAACGAGCTAAGATCGGATCCTCGTATCGCTGCAAGCATCCTTCGTCTTCACTTCCACGACTGTTTCGTCAAT
GGCTGTGATGCA
TCGATCCTGTTAGACAACACAACATCCTTTCGAACAGAGAAAGATGCGGCTCCAAACGCAAACTCGGCTCGAGGATTTCCAGTGATCGATAGAATGAAAGCAGCAGTAGAGACAGCATGT
CCAAGGACTGTTTCATGCGCAGATATACTTACCATCGCAGCTCAACAAGCTGTAAATTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGAAGAGATAGCTTACAAGCATTCTTT
GCTCTCGCTAATACAAATCTTCCCGCTCCATTCTTCACTCTCCCACAACTTAAGGCCAGTTTTCAAAATGTTGGACTTGACCGTCCCTCTGATCTCGTTGCACTCTCTG
GTGGTCACACA
TTTGGTAAAAACCAGTGCCAATTTATTATGGATAGACTATACAACTTTAGCAACACTGGTTTACCCGACCCTACTCTTAATACTACATACCTCCAGACACTTCGTGGACAATGTCCCCGC
AATGGTAACCAGACCGTCTTAGTTGATTTCGATCTACGCACACCGACGGTTTTTGACAATAAATACTATGTGAATCTGAAAGAGCTAAAGGGACTTATCCAGACGGATCAAGAGTTGTTT
TCCAGCCCTAATGCCACTGACACAATCCCCTTGGTGAGAGAATACGCTGATGGCACTCAAAAATTCTTCAATGCTTTTGTGGAAGCAATGAATAGAATGGGAAACATTACACCTCTCACT
GGAACTCAAGGACAAATCAGACAGAATTGTAGGGTGGTTAACTCCAACTCGCTGCTACATGATGTGGTCGAAATCGTTGACTTTGTCAGCTCTATGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCTCATCTTC TCAAACTAAA TCAATTAAAG AGGTTTCTTC TTATAGAAAT GAATTTCTCT TATTCTTCCT TGTCAACTTG GACAACCCTA ATGACATTGG GTTGTCTTCT GCTTCATTCA  TCCATTTCCA GTGCTCAGCT AACCCCAACT TTCTATGACA ATACATGTCC AAGCGTCTTT ACCATCGTAC GGGATACCAT AGTAAACGAG CTAAGATCGG ATCCTCGTAT CGCTGCAAGC  ATCCTTCGTC TTCACTTCCA CGACTGTTTC GTCAATGGCT GTGATGCATC GATCCTGTTA GACAACACAA CATCCTTTCG AACAGAGAAA GATGCGGCTC CAAACGCAAA CTCGGCTCGA  GGATTTCCAG TGATCGATAG AATGAAAGCA GCAGTAGAGA CAGCATGTCC AAGGACTGTT TCATGCGCAG ATATACTTAC CATCGCAGCT CAACAAGCTG TAAATTTGGC AGGAGGTCCT  TCTTGGAGGG TTCCTTTGGG GAGAAGAGAT AGCTTACAAG CATTCTTTGC TCTCGCTAAT ACAAATCTTC CCGCTCCATT CTTCACTCTC CCACAACTTA AGGCCAGTTT TCAAAATGTT  GGACTTGACC GTCCCTCTGA TCTCGTTGCA CTCTCTGGTG GTCACACATT TGGTAAAAAC CAGTGCCAAT TTATTATGGA TAGACTATAC AACTTTAGCA ACACTGGTTT ACCCGACCCT  ACTCTTAATA CTACATACCT CCAGACACTT CGTGGACAAT GTCCCCGCAA TGGTAACCAG ACCGTCTTAG TTGATTTCGA TCTACGCACA CCGACGGTTT TTGACAATAA ATACTATGTG  AATCTGAAAG AGCTAAAGGG ACTTATCCAG ACGGATCAAG AGTTGTTTTC CAGCCCTAAT GCCACTGACA CAATCCCCTT GGTGAGAGAA TACGCTGATG GCACTCAAAA ATTCTTCAAT  GCTTTTGTGG AAGCAATGAA TAGAATGGGA AACATTACAC CTCTCACTGG AACTCAAGGA CAAATCAGAC AGAATTGTAG GGTGGTTAAC TCCAACTCGC TGCTACATGA TGTGGTCGAA  ATCGTTGACT TTGTCAGCTC TATGTAACAT AACGTTGTCT CGATATATGT GGCAACCAAA AATATGTTTT ATGAAATAAA GTGTTCTCAA AATGTTTATG AAGAACATTT CGTCTTAAAT  CTTTTCTGTC CTTCATGTTT TTCTTATTAC TTTTTCAAAG TAATCTATCT ACCCTCGATT GATGGAAAAT AGAACTGAAA CGAATAGCAT GGTTAATTTA CTTAAGAAAT AATATGTAGT 
GTTTTTTTTT ATATTTGTGA ATCTAAATAT TTTAATGTTT ACTATTCAAG AAATTTTAGA TCTTTTTAGA TTTTAATGGA TGATTGTTTG GATT 

Retrieve as FASTA