Entry information : AtPrx33 (At3g49110 / Athprxca / prxCa / AtPCa)
Entry ID 199
Creation 2006-06-16 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtPrx33 (At3g49110 / Athprxca / prxCa / AtPCa)
Name (synonym) AtPrx33 (At3g49110 / Athprxca / prxCa / AtPCa)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Cell wall
Tissue types Mixed tissues
Roots
Rosettes
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx33
start..stop
S start..stop
AlyPrx33 684 0 1..354 1..349
AhalPrx39 673 0 13..354 14..355
CrubPrx107 667 0 13..354 12..353
AtPrx34 661 0 13..354 12..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18200713..18200946 234 N° 2 18201507..18201698 192 N° 3 18202163..18202331 169 N° 4 18202422..18202891 470
join(18200713..18200946,18201507..18201698,18202163..18202331,18202422..18202891 )


exon

Literature and cross-references AtPrx33 (At3g49110 / Athprxca / prxCa / AtPCa)
Literature Intapruk,C., Yamamoto,K., Fujiyama,K., Takano,M. and Shinmyo,A. Cloning of cDNAs encoding two peroxidases of Arabidopsis thaliana and their organ-specific expression. J.Ferment.Bioeng. 75 (3), 166-172 (1993)
REFERENCE 2 Sundaravelpandian K, Chandrika NN, Schmidt W.
. PFT1, a transcriptional Mediator complex subunit, controls root hair differentiation through reactive oxygen species (ROS) distribution in Arabidopsis. New Phytol. 2013 Jan;197(1):151-61.
Protein ref. UniProtKB:   P24101
DNA ref. Phytozome 11:   Chr3 (18200713..18202891)
mRNA ref. GenBank:   NM_114770
Cluster/Prediction ref. Phytozome Gene 11:   19664624 UniGene:   At.23913
Omic ref. AtProteome:   At3g49110 ATTED-II:   At3g49110 e-FP Browser:   At3g49110 ePlant:   At3g49110 Genevestigator:   At3g49110 TAIR:   At3g49110
Protein sequence: AtPrx33 (At3g49110 / Athprxca / prxCa / AtPCa)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (323)
PWM (Da):   %s   38785.41 (35470.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.86 (7.31) Peptide Signal:   %s   cut: 32 range:32-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQFSSSSITSFTWTVLITVGCLMLCASFSDAQLTPTFYDTSCPTVTNIVRDTIVNELRSDPRIAGSILRLHFHDCFVNGCDASILLDNTTSFRTEKDALGNANSARGFPVIDRMKAAVERACPRTVSCADMLTIAAQQSVTLAGGPSWKVPLGRRDSLQAFLDLANANLPAPFFTLPQLKANFKNVGLDRPSDLVALSGAHTFGKNQCRFIMDRLYNFSNTGLPDPTLNTTYLQTLRGQCPRNGNQSVLVDFDLRTPLVFDNKYYVNLKEQKGLIQSDQELFSSPNATDTIPLVRAYADGTQTFFNAFVEAMNRMGNITPTTGTQGQIRLNCRVVNSNSLLHDVVDIVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns), 3 cDNA and 7 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAAAGTACCA TCAAAACTCG CATTCATGAC TGTCATGTAC ACACACTCAC AAGAAGAGGT CATGGGTTAC TATGCACGCA AGATTTGGGG ACTTCCACAA AATAAATTAA GTATATTTAG  AAATGTAAGA ATTGTGGGAC CCACTGGTAG GGGCGGTTGG GGCGATACAA TACGATTCGA GAATAATATC AGACCTTAGA ACTTAAGCTT TAGTTGACAC CCTACATACA AATACATTTT  GTGTCACAAC GTTAGTGCAA AATATAATAT TAAATCTGGT ATCTATCTTA TACATTTTGA ACATAAGAGA AAGCACGTAG GAACATCCAT TGATTGTTAT ATGAAGCAAT ATGGTATTTC  ATGGGGAAAA AGCTTAAGAA GAGATCAAAA TCATGGCATT TGATTCAAGG AAGAGTCTTA ATTAATCAAA GAACTAATGA CGAGAGATCA CTCTTTTCCT TTTCCTTTCC CTATCGTCAT  GTGATTCCTA AACCTCTCGA GGGTCGTAGA AGTTTTCTAC AAAGAGACTG ACATTTTCAC ACATCCTGAG TTGATGAAAC ATCACGTTGT TTCTTAATTC CTTAACAATA CATCTCTTTT  GATCAGAACT ATACGACTAT GCAAGTTCTT TTTTTAGTTT CTCCGTTTAA TCTTTTATGT TGTGTGGAAA TAAGCGGTTT TCTTATGTGA CAATGTGCGT TTTTTTTTGT CTGTTTCGAA  TCCTCAATAT GACGAAGATT AATACATTTA TGGTTGTGTT TCTTTTGTGT TGTATAAATA TGTGTTTGTT TTATTTTCAA TAATAAGCTT GGTTTGGTTT CCATTGTTTG AATTTATTGG  GTATACATAT TAGACCAATT AGAATTCCAC TTGTAAATGC ATATTCTGGA ACAATAATGT TGACTATACT AATAATTTTT TCTTGGGTCT AAAACATTTA GTATACTTTT CTTGAATTTT  ATGTAAAGTT ATTCTGTTTT TAGGACTTTT ATCCTCACTG AATTATGTTG TGTTAAAGTA GTAGCTTATA TGGTCACATA TCTCACACGT GTTTCCATTT TTTTTCTATC TAAGTTTTCG  GTTTTTACAT TGTATACAAA AATAAATGGC ATGCCTTGGG CCTTGGCCAC TGATTCACAT GATCACGTAG AGTTTGTGTG TGATTCAAAT CCTAGATGAG AAGATCATCC AATTGATCTA  AGATGTGTCT TTCTTATATC ACACGTTTTA TTTTAATAAT ACTCTTCAGT TGGGTTTGAT TCCATTTATG ATTTATCTAT GAAAACAGAA TATGTCCTCA TGCTGATTAT TTCGTTTGTG  GTTGCATTTT ACCATCTGTA GTTTTTTTTG TTTACTGACA AACAACTAAG ATTTTATGAA TTCATTTGAT GATAAATAGT TAATCAAATA TATTATTATG AGTGACTCGA TGGCGAAAGC  TGGTATTATC TTATGGCTGC TAAAGTCTAC TTTTAGAAGA AGAAAAAAAA AGGGTCTGTT GCATTACCCT GTTGTTGCGA CTCTCCTACA ATAACTCTCA CGTGGCCCGT TTCTTGGTTT  TTGCCCTATT TTCACAAAAG TAAACAGAGA TTTTCACTAG CAAATTGGGC CCAATTGGAG ACAACTTCAT GTGGTTTGAA TCGTATATTT CAGATAGATT AGACATCTAG TCTTCTTTGA  TGTGCGGTGA GGATCTTAAG TCGCTATAAC GTTGTGAAAA AAGAAAAGAA AAAGTCACTA TAACATAGAT CGCAACTAAA CAAATAAAGG ACACTATACA TGTACGTAAT AATATTCATT  TATTTTCAAC GACAATGTTC CCTAGGGTGG TAACCCAAGT ATTTTTCATA GATATTATAC TTCTAGCGAA AAGCCATCAA TTGAGAAAAA AGGCCTCCAC GTTTGACCCG TTTTGCCTAT 
AAAAGGATTC TTTAAGATAT GGACCTTACT CATCTTCTCC GTTAAACCCA TTTAAATAGT TTTCATTGTC CTTGTGAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAATAGTTGA CTCAATATCT GGCGACCAGA CTATATGTTA AGATAAATAA GCGGGATCTC AAGTTGTTAC TTGAGCAGGA GCAGATTGTA TTGGTGTTTA TAGTATCCAA GTAGTTCTCT  GTTTTTTTTT TATATTGGCC TTTGATAGCG TTTTGTTAAT CGGTCTAAGC TTCTATGGTT TTGGACTGTT TTATCCTAAT AAATATGACA AGATAAAACG TTTATGTTAT TTGAAAATAT  TTTGTCCTAC GTTTCCATTT CTCTAGTGAT GTATATAAAA GAAGAATGTG TGATCTAGCA AAATTGAAAT ATGAATATGG TTCAAGATTG TCGTGATACA TAGTCAGATA TATAAAGAAT  AAAACGTATC TAACTTTGTG GCCTTGCATT GATTTATGAT ACGTAAAAAA AGGACGCGAC AAATATGAGC CTGGCGAGTC TCTCCGAACA CACAATAATT CTGGTGGAAC GAGAAGCGAT  TCATAGGGTT ATCAAGAGGT CTAATTTCAA GCTGAGAGGC CTTTATGAAG ATTAAATTAA GATCAGTTGA GAAACTCAAG CATTGGAGGG GAGAGGATGC GGCTAGAAAC TTAGATATGG  AAGCTTCATA AATACTTAAC TGATGAGAAA GATGAATCGC GTAAGTTACA AATGGAGCTT GCTGGAATTT AGAAGAGTCT ATGTGTGTTC AAAAATGATA ATCACAAAGT TTATTATGTA  TGTAGCAAAG CTTAAAAAGA AACTTGTAGC TGAAAAGAAA AAAACCTAAG CTGTTCAAAG AATGAACTTT TGGAGAACTT GAATAAAACA AGGATTCTCA ATGGTGTAAC AAATAATCCA  TATAAATTTT TTGAGCATAT AGAGGCGAGA GAAGAAGAGT ATTGGTACGA GTTATAACAA AGAAGCTAAT TAAGTACATC TAGATCAAAT ATTGTATTTG GTAGAAATGC ATAACATAAA 
AAAAAAAACT CACGACTAAC ATGTCAAAAG GAACATGCGC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATTCTCTTCATCTTCTATTACTTCTTTCACTTGGACAGTTTTAATCACAGTGGGATGTCTTATGCTTTGTGCGTCTTTCTCCGATGCTCAACTTACCCCTACTTTTTACGACACT
TCATGTCCTACCGTCACCAACATTGTAAGAGATACCATTGTCAACGAGCTAAGATCGGACCCTCGTATCGCCGGGAGCATCCTTCGTCTTCACTTCCATGACTGCTTTGTTAAT
GTAAGA
TATCACTTTTCATATATCTATAGCGTTATGAAATTACTGTACTTAATCTCTTCATCTTTTAAATATTGATTAAATCAGTGTAAAAAAGATTATAGTTGTTGTCAGCATTAGCAATTGTTT
TAGGTGTACTCTTAGTTGCTTTCAATTTAATGTCATTTTAGCTTTTCTTTTATGTTTCAAAATTTGGATTCTGAATGCAAATTTTAAAGGAAAAAGTAATTTAACATCACGTCAAAATTA
ATCAAACAGACAAAGAATCAATTAGTTTTGGAATCACGTAGTAGTATAATGGAACTTATTAAATTTCCACCATATTTTGGTAATATAAATTTTTCTTTTACTGAATTTATTTTAGTGAAT
TAAAATGGGTTAGAACTTAGAAGAGTTAATTCCTCCTTACATTGTTTTCCTTAACTCAGTTACTTGCTTCAGAGGAACAAATGGTTTTAATGGATGAAAAAAGTTCAACGTTAAACTGTT
ACCTTTGGTAAAGATGTAAACTATGGATGACATTAACTAATAATTTGTTAAATAATATTTTGGACTTTTGAAAGGGTTGTGATGCTTCGATCTTGTTAGACAACACGACATCATTTCGAA
CAGAGAAAGATGCACTTGGAAATGCAAATTCAGCCCGAGGATTTCCAGTGATTGATAGAATGAAAGCTGCGGTGGAGAGGGCATGCCCAAGAACCGTTTCATGCGCAGATATGCTCACCA
TTGCTGCTCAACAATCTGTCACTTTG
GTATGCTCCATTGTCCCATATTCTTTTATTCATTACACACATTGTTCGATATAAATATGTCAAGTAGTCGCTTTACGTACATGTTAAACATGAC
AGTCTAAGTTCGAAAATAAAATTGTTGGTATATTTTATGTCTTTTAGAATGTCACAAACTCCCAATATATGTTTAGAATAAAATAGACAAGTATTCAAAATTAATCGGAAAACATTCAAA
ACACTCCCGTTGATATTTTTTGATAATTTTAATATCACTGAGAAAATAAGGTCTCATCACTATGATTTATGTACCTTTTTAGTTAACAAAATAGAAGAAAATTCCTTTTCATCCAAGAAA
GAGACCATGGAAATTACCTTTGAGTTTTGAGTATATAATCAATAGATTTATAAAACATGTTTCAGGGTAATAATATTTTCTAAGAAAAGAATTATTATTTTGAATATAATGGTTAATTAT
TATACTATAGGCAGGAGGTCCTTCTTGGAAGGTTCCTTTAGGGAGAAGAGACAGCTTACAAGCATTTCTAGATCTTGCTAACGCAAATCTTCCAGCTCCATTCTTCACACTTCCACAGCT
TAAAGCCAACTTCAAAAATGTTGGCCTCGATCGTCCTTCTGATCTTGTTGCGCTCTCCG
GTAATTATTAAAAAGAAATGAAACCTTGTTTGATATAGTTGTAATTTAGCAAGTTAATCGT
TGATCTAATTATGGTCTTCCTTTTGTTAGGGGCTCACACATTTGGTAAAAATCAATGTCGATTCATTATGGACAGATTATACAACTTTAGCAACACTGGATTACCTGACCCTACACTCAA
CACTACTTACCTCCAAACTCTTCGTGGTCAATGTCCTCGCAATGGTAATCAAAGCGTCTTAGTGGATTTCGATCTGCGTACGCCTTTGGTTTTCGACAACAAATACTATGTGAATCTTAA
AGAGCAAAAAGGTCTTATCCAGAGCGACCAAGAGTTGTTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGAGCATATGCTGATGGCACACAAACATTCTTCAATGCATTCGT
GGAGGCAATGAATAGGATGGGAAATATTACACCAACTACAGGAACTCAAGGACAAATCAGGTTGAATTGTAGAGTGGTGAACTCCAACTCTCTACTCCATGATGTGGTGGATATCGTTGA
CTTTGTAAGTTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATTCTCTTCATCTTCTATTACTTCTTTCACTTGGACAGTTTTAATCACAGTGGGATGTCTTATGCTTTGTGCGTCTTTCTCCGATGCTCAACTTACCCCTACTTTTTACGACACT
TCATGTCCTACCGTCACCAACATTGTAAGAGATACCATTGTCAACGAGCTAAGATCGGACCCTCGTATCGCCGGGAGCATCCTTCGTCTTCACTTCCATGACTGCTTTGTTAAT
GGTTGT
GATGCTTCGATCTTGTTAGACAACACGACATCATTTCGAACAGAGAAAGATGCACTTGGAAATGCAAATTCAGCCCGAGGATTTCCAGTGATTGATAGAATGAAAGCTGCGGTGGAGAGG
GCATGCCCAAGAACCGTTTCATGCGCAGATATGCTCACCATTGCTGCTCAACAATCTGTCACTTTG
GCAGGAGGTCCTTCTTGGAAGGTTCCTTTAGGGAGAAGAGACAGCTTACAAGCA
TTTCTAGATCTTGCTAACGCAAATCTTCCAGCTCCATTCTTCACACTTCCACAGCTTAAAGCCAACTTCAAAAATGTTGGCCTCGATCGTCCTTCTGATCTTGTTGCGCTCTCCG
GGGCT
CACACATTTGGTAAAAATCAATGTCGATTCATTATGGACAGATTATACAACTTTAGCAACACTGGATTACCTGACCCTACACTCAACACTACTTACCTCCAAACTCTTCGTGGTCAATGT
CCTCGCAATGGTAATCAAAGCGTCTTAGTGGATTTCGATCTGCGTACGCCTTTGGTTTTCGACAACAAATACTATGTGAATCTTAAAGAGCAAAAAGGTCTTATCCAGAGCGACCAAGAG
TTGTTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGAGCATATGCTGATGGCACACAAACATTCTTCAATGCATTCGTGGAGGCAATGAATAGGATGGGAAATATTACACCA
ACTACAGGAACTCAAGGACAAATCAGGTTGAATTGTAGAGTGGTGAACTCCAACTCTCTACTCCATGATGTGGTGGATATCGTTGACTTTGTAAGTTCTATGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCTTCTCCG TTAAACCCAT TTAAATAGTT TTCATTGTCC TTGTGAAAAA TGCAATTCTC TTCATCTTCT ATTACTTCTT TCACTTGGAC AGTTTTAATC ACAGTGGGAT GTCTTATGCT  TTGTGCGTCT TTCTCCGATG CTCAACTTAC CCCTACTTTT TACGACACTT CATGTCCTAC CGTCACCAAC ATTGTAAGAG ATACCATTGT CAACGAGCTA AGATCGGACC CTCGTATCGC  CGGGAGCATC CTTCGTCTTC ACTTCCATGA CTGCTTTGTT AATGGTTGTG ATGCTTCGAT CTTGTTAGAC AACACGACAT CATTTCGAAC AGAGAAAGAT GCACTTGGAA ATGCAAATTC  AGCCCGAGGA TTTCCAGTGA TTGATAGAAT GAAAGCTGCG GTGGAGAGGG CATGCCCAAG AACCGTTTCA TGCGCAGATA TGCTCACCAT TGCTGCTCAA CAATCTGTCA CTTTGGCAGG  AGGTCCTTCT TGGAAGGTTC CTTTAGGGAG AAGAGACAGC TTACAAGCAT TTCTAGATCT TGCTAACGCA AATCTTCCAG CTCCATTCTT CACACTTCCA CAGCTTAAAG CCAACTTCAA  AAATGTTGGC CTCGATCGTC CTTCTGATCT TGTTGCGCTC TCCGGGGCTC ACACATTTGG TAAAAATCAA TGTCGATTCA TTATGGACAG ATTATACAAC TTTAGCAACA CTGGATTACC  TGACCCTACA CTCAACACTA CTTACCTCCA AACTCTTCGT GGTCAATGTC CTCGCAATGG TAATCAAAGC GTCTTAGTGG ATTTCGATCT GCGTACGCCT TTGGTTTTCG ACAACAAATA  CTATGTGAAT CTTAAAGAGC AAAAAGGTCT TATCCAGAGC GACCAAGAGT TGTTCTCTAG CCCCAATGCC ACTGACACAA TCCCCTTGGT GAGAGCATAT GCTGATGGCA CACAAACATT  CTTCAATGCA TTCGTGGAGG CAATGAATAG GATGGGAAAT ATTACACCAA CTACAGGAAC TCAAGGACAA ATCAGGTTGA ATTGTAGAGT GGTGAACTCC AACTCTCTAC TCCATGATGT  GGTGGATATC GTTGACTTTG TAAGTTCTAT GTGAGAATAG TTGACTCAAT ATCTGGCGAC CAGACTATAT GTTAAGATAA ATAAGCGGGA TCTCAAGTTG TTACTTGAGC AGGAGCAGAT  TGTATTGGTG TTTATAGTAT CCAAGTAGTT CTCTGTTTTT TTTTTATATT GGCCTTTGAT AGCGTTTTGT TAATCGGTCT AAGCTTCTAT GGTTTTGGAC TGTTTTATCC TAATAAATAT 
GACAAGATAA AACGTTTATG TTATTTGAAA ATATTTTGTC CTACG 

Retrieve as FASTA