Entry information : AtPrx34 (At3g49120 / Atprxcb / AtPCb / ATPERX34 / PERX34)
Entry ID 200
Creation 2006-06-16 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtPrx34 (At3g49120 / Atprxcb / AtPCb / ATPERX34 / PERX34)
Name (synonym) AtPrx34 (At3g49120 / Atprxcb / AtPCb / ATPERX34 / PERX34)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Cell wall
Tissue types Etiolated hypocotyls
Leaves
Mixed tissues
Roots
Rosettes
Siliques
Inducer Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx34
start..stop
S start..stop
AlyPrx34-1 680 0 1..353 1..353
AhalPrx22 674 0 1..353 1..353
BrPrx34-1Ab_other 672 0 7..353 3..349
BstrPrx03 666 0 1..353 1..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18207819..18208049 231 N° 2 18208803..18208994 192 N° 3 18209312..18209480 169 N° 4 18209572..18210041 470
join(18207819..18208049,18208803..18208994,18209312..18209480,18209572..18210041 )


exon

Literature and cross-references AtPrx34 (At3g49120 / Atprxcb / AtPCb / ATPERX34 / PERX34)
Literature REFERENCE 1 Shah,K., Penel,C., Gagnon,J. and Dunand,C. Purification and identification of a Ca(2+)-pectate binding peroxidase from Arabidopsis leaves. Phytochemistry 65 (3), 307-312 (2004).
REFERENCE 2 San-Xiong Fu, Hao Cheng and Cunkou Qi. Microarray analysis of gene expression in seeds of Brassica napus planted in Nanjing (altitude: 8.9 m), Xining (altitude: 2261.2 m) and Lhasa (altitude: 3658 m) with different oil content. Molecular Biology Reports 2009.
REFERENCE 3 Sundaravelpandian K, Chandrika NN, Schmidt W.
. PFT1, a transcriptional Mediator complex subunit, controls root hair differentiation through reactive oxygen species (ROS) distribution in Arabidopsis. New Phytol. 2013 Jan;197(1):151-61.

Protein ref. UniProtKB:   Q9SMU8
DNA ref. Phytozome 11:   Chr3 (18207819..18210041)
mRNA ref. GenBank:   NM_114771
Cluster/Prediction ref. Phytozome Gene 11:   19663363 UniGene:   At.23788
Omic ref. AtProteome:   At3g49120 ATTED-II:   At3g49120 e-FP Browser:   At3g49120 ePlant:   At3g49120 Genevestigator:   At3g49120 TAIR:   At3g49120
Protein sequence: AtPrx34 (At3g49120 / Atprxcb / AtPCb / ATPERX34 / PERX34)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (323)
PWM (Da):   %s   38676.49 (35542.0)  
PI (pH):   %s   7.7 (7.70) Peptide Signal:   %s   cut: 31 range:31-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFSSSSTSSTWTILITLGCLMLHASLSAAQLTPTFYDRSCPNVTNIVRETIVNELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFPVIDRMKAAVERACPRTVSCADMLTIAAQQSVTLAGGPSWRVPLGRRDSLQAFLELANANLPAPFFTLPQLKASFRNVGLDRPSDLVALSGGHTFGKNQCQFILDRLYNFSNTGLPDPTLNTTYLQTLRGLCPLNGNRSALVDFDLRTPTVFDNKYYVNLKERKGLIQSDQELFSSPNATDTIPLVRAYADGTQTFFNAFVEAMNRMGNITPTTGTQGQIRLNCRVVNSNSLLHDVVDIVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns), 10 mRNA and 265 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCTAAAGTC TACTTTTGGT TGGATCTGTG GTCGGAAGAT CTTGACGTGA TCACTTCTAT AATTGAGGAT TGTGTGTTGC TGCTACTCTC CTCTCACGAT AACTCACGTG GCCTTTTTCT  TGTTTTTCTT TCTTCATATT TTCACAAAAC AAAATAGTCA GAGATCTTGA GAGATTTTTT CAGAAGCATA TTGGGCCCAA ATGTGGACAA TTTCATGTGG TTGAATTGTT AAATTTCAGA  TAGATTAGAC AACTAATCTT GTTGACGTGC ATGCGGTGAG GATATTAAGT CGCTATACGT CATATACGTG TATACTTAAA ATCTCGTTTG ATATTTCTTT CTTTTGTTTT TATCTTCAAC  GACAATTATT GCCTCAGGCA TGTCAGCAGA AAACGACACC GTTCATATTC GATCTCGTTA TTAATATGTT TTTGAAGCAA AATATCATTA TTAGCTATGG AGTTTCTGCA GTAGCCTAAC  CGGAAGTCTC AAAAAGATAA CGTTTATGCC GGTTATAATT AAATCCGATA AGGCGATAAA TAAGTGAACC CGTAAAGTCT AAAATTTTCA CATATATATG AACAAAGAAA TAGTCTATAG  ATCTCCATGC ATTCTTGTAC AAACATATTT AATTTTTTAT TTTATTTTCT TTATATAAGA GTTGGTGTAT GAAACTTTAC ATTTTGTAAA TACTAACATT ACATCATAAT GTCAGAACCA  ATAATTCTAG TGGAATGATA TAATCTCCAC TTTAAATTCT TATGTCTTTA TCCAAAGAGA TCATGAGGAA CTTGAGCAAA GGAAGAGGGC ACCGTTTAGT AGTATAGGTG AATAACGTGG  CGGACACGAG GCTGGTCTCA TTTTCAAATA AAGAGAGATA GAGAGAAAAT GGAAGGAAAA AAAAGCTATT GGCGATGTTG ATATTTGTTC GTCTTTTAGT GGAGACGACC AAGAGATTTT  GAAAGGTCGT CGAGGAGTTA GTTTATTATC TTACAATTAT TATGGATTTC TTCTGACTAA AGTTTTAGTG CAATAGTTTT CTGAGTTATT ATATATTTTT CGAAATTCAT CCAAAGGCTA  AAACTTTGTA AGGTATTCTG AGTCTATTAC GCTAGAAATA GACACGCTTA CGTTTTTAAG TCATTTTAAT CTGATATATA TATATATATA TATATACTAC AATTTTATAA CCAATTATCT  TTGTTTCAGA CAATTTATAT AAATTCATAT AAACTATCAG AAATAAAGAG ACAATTGGCT GTAAAATTGT ATTATTTTGC ATCTATGAAA TTTTTATTTC TCTTTATCAA AATTGAAGAC  GAGTTGAAAT TCTATTTCTT TTTTAAAAAA ATTTATATAT GGGAGTGTCA AAAAATAATT TTCCTTTGTA AGAGAATATT CGTATTTGGA CGAGTCTTGA TTTGTGTTTT CCGTTAGCGT  TCCACATTAG TTGTAAAGAG CGAGAAAGAT TTAAGTGATA ATTAAAAAGA CAAGATATGC ATTTTGAATA TACTCTAGAT ATTAATCTTA AGCATTTTTC ATATTGGTTA TATTTTATGG  TCGAATTTTG ACATCCGAAA AATACATCCC TTATTCTTCA ATTTATATTG AATACTTAAG TTTTTGATAG TAAATATGTA TAAATAAATT TTAAACAATT GTCAAAAAGA CATTATAACT  TATACGGTTA TAGTTGTTAA AAAAAAAACT TATACGGTTA TACCAATAGA TAAACTGACA TTTTAGATTT GAGTTTTTTT TTTTTTTACT TTCCATGTAG ATAGCGTGGA ATAATACCTC  ATTTATATGT ATCGTTAGTT GAAATAATTG ACAAAAGGAA ACTATTCGTT TGCTGTTCTA GATAAAAGCC TTTAATTGAG AAAAAGAAAA TGCCTCCAGC TTTGACCCGT TTTGCCTATA 
AAAGGATTCT CTAAGATATG GACTTTCCTC ATCTTCTCGG GTAAACAGAA TCAACTAGTT TTGTTTTTCC TCTTTCAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAATTGTTTA CCCAATATGT GGCTACAAGA ATACATATAT ATTAATGAAT AAAACTCTCA AGACGTTTAC TTGAGAACAT TTATTTTAGT TCTCTCCTTT TCTAGAAGTG TATATACGCC  ACCACTAGGT GTCTCTCACT CAAGGAGAAG CAGATTTGTA TTATTAAGCT CATTGCGCAG TTTGTGGCGG GGTATGGGAA GGTGTTTCAA CGGGATTTGA AGGCGATAAT TGTTAAGAGC  CATGAGCAGT TTGACTTTTT GAAGCCAACT AATAGCAACT TCGGTCTTTT TAATGCCCTT GTTACTTCGT ATTCACGAGT ATTAAAACAT TCCAAGGGTT CTCCCTCCTT TCTTGATCGT  ATTTTCGACC ATCTTCGATT GGAGAAGCTG GAGGAGGGAA GGGATACGGT TATGGTTGAT TTGTTTGACT TTGTTGGAGG AGGGAGTAGA GACTGCTGCG ATCGATTAAC ATGCTTTTGT  GAGTGGTGTT GACCGTTTTT CTCACATTGC TGATGAAGAT TATTCTGCTG CCATGCCACC ACCTGAACGC CTTTCGGTGA TGATCATGAA CCGAGTAGCA CAAACACAGC CTGATATGGT  TTTGCAGCTT CCACTGGGAT CTCAGCTTAC TAGTGAATAT AAAGTGTAGG TGATTCTTTT AGGTCTCCTA CTCTAAAAAG ACTAACATTA AGAGTCCCTG CAAAGGGGAT TACACTCAAG  GAGCTTGGTG TTATGAAGCT GACAGCGCAG TCTTCGGTGC GATATGGGTT TGATTTTTGG TGTGGTTTAT GGAAGAGAGT GTATATGAAC CCATTGTTTC AGTTCTTGAA TCCTTCCGAT  AGCCGTTCCG ATTTTTACAA TGGGTTTACT GCTGCGTATT CCAGAGTGTT AAAGCCTTCT AAAAAGCTGA AGAAGTTTGA TGCTTGTACG GCGACCGTGC TTGAGGGGTT TTTCCACCGT 
CTTCACCTGT TTAAGCTGGA AGAGGGAGTG GAAACTGCTA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTCTCTTCGTCTTCAACATCGTCCACTTGGACAATCTTAATCACATTGGGATGTCTTATGCTTCATGCATCTTTGTCCGCTGCTCAACTCACCCCTACCTTCTACGATAGGTCA
TGTCCTAATGTCACTAACATCGTACGAGAAACCATTGTAAATGAGTTAAGGTCGGACCCTCGTATCGCTGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GTAAGATAT
TACTTTTTATATATCTATAGCGTTGCGGATTACTGAGGGCCATCTTTTAAATATTAGTAAAGCAGTGTAAAAAGTAGGAAACAAAAGTGATAACAAGTGTATTTTGTCATCAGCAGATTC
AGCACACGCAATTGTCTTAGTTAATACTCTTTTTGCTCAAAGACTAAATTTCACGTAGTTAGATGTTACTAGTTGTTAACTGCTTTTCTTTTTCTATATTGAAAATTAATATTACTCATC
GACAGTGATGTTACTGGTTAGTTGTTAATTTCTTACACAATGATGATGCCAAAACATTTATGCAATCGGATTCACGAAAATAAAGTATCCGTGTTACAGTCTAAGGAATTGCATGGTGCC
GTACCAAACACGATAGAAATTTAAGATCCATCAATCATTTTTCTTTTTTGGTTGAGGGATATATATTTAAAAAATAATTCTAAAATCATGATTATTAATTTTTATAATTCAATTAAAATT
TTGATGAATTTAAATATTTTAATGTGATTATATATAAGTATTTCGGTATACAAATATTATTTCGGTATGGTTTATTTTCTATTGAGTTAAAATTGGTTAAAGGAGTTTCTCTATCACTTT
GTTTTCATTATAATTTAGATATTTACAGATATACCTTCACTGATTACTTGCTTCAGAGGAACAAATGGTTTTAGTGAATGGCAAAAAAGTTTTTAATACATTCATGACTAATGATTTGTT
AAATAAATTTTTGGACTTTGAAAGGGTTGTGACGCATCCATCTTGTTAGACAACACGACATCATTTCGAACAGAGAAAGATGCGTTTGGAAACGCAAATTCGGCTCGGGGATTTCCAGTG
ATTGATAGAATGAAAGCTGCGGTGGAGAGGGCATGCCCAAGAACCGTTTCATGCGCAGATATGCTCACCATTGCAGCTCAACAATCTGTCACTTTG
GTATGCTCCATTGTCCCATATTCA
TTTACAAACACTGTTTTCAATATGAAAAGTATTCAATATTAATTGAAAAAAGCGCGTGGTCCCGTTAAGAAAATTTGACAAAATTAGGTCTCATATCACTAGCTTTGATATCATATTAAC
CCAAAAGAATAATATTCAACTTTTTTCTCAAGAAATAGTGGATATATAAAAATTTACTTTGTGTATATATATCTAATCAATGAATTTATATTACATGACTCTCTTTTTCTCTTTACATGT
TAAAAATAATCTCAAGAAAATATTATTGTAATATAATGGTTATTATACTATAGGCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGGAGAGACAGTTTACAAGCATTCCTGGAACTCG
CTAATGCAAATCTTCCAGCTCCATTCTTTACACTTCCACAACTTAAAGCCAGCTTCAGAAATGTTGGTCTCGATCGTCCTTCTGATCTCGTTGCTCTCTCCG
GTAATTAACAAAAGAAAA
TTAAACACCATTGATACAATATCAATTAGCGATAGTTTATTACTAATCTAATTATGGTATTTGTTTTGTTTAGGTGGTCACACATTTGGTAAAAATCAATGTCAGTTTATTCTTGACAGA
TTATACAATTTCAGCAACACAGGTTTACCCGACCCTACACTCAACACTACTTACCTCCAAACTCTTCGTGGACTATGCCCCCTTAATGGCAATCGAAGTGCCTTGGTAGATTTTGATCTA
CGTACGCCTACGGTTTTCGACAACAAATACTACGTGAATCTCAAAGAGCGAAAAGGTCTTATCCAGAGCGACCAAGAGTTGTTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTG
AGAGCATATGCTGATGGCACACAAACATTCTTCAATGCATTTGTGGAGGCAATGAATAGGATGGGAAACATTACACCAACTACAGGAACTCAAGGACAAATCAGATTGAACTGTAGAGTT
GTGAACTCCAACTCTCTGCTCCATGATGTGGTGGATATCGTTGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTCTCTTCGTCTTCAACATCGTCCACTTGGACAATCTTAATCACATTGGGATGTCTTATGCTTCATGCATCTTTGTCCGCTGCTCAACTCACCCCTACCTTCTACGATAGGTCA
TGTCCTAATGTCACTAACATCGTACGAGAAACCATTGTAAATGAGTTAAGGTCGGACCCTCGTATCGCTGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GGTTGTGAC
GCATCCATCTTGTTAGACAACACGACATCATTTCGAACAGAGAAAGATGCGTTTGGAAACGCAAATTCGGCTCGGGGATTTCCAGTGATTGATAGAATGAAAGCTGCGGTGGAGAGGGCA
TGCCCAAGAACCGTTTCATGCGCAGATATGCTCACCATTGCAGCTCAACAATCTGTCACTTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGGAGAGACAGTTTACAAGCATTC
CTGGAACTCGCTAATGCAAATCTTCCAGCTCCATTCTTTACACTTCCACAACTTAAAGCCAGCTTCAGAAATGTTGGTCTCGATCGTCCTTCTGATCTCGTTGCTCTCTCCG
GTGGTCAC
ACATTTGGTAAAAATCAATGTCAGTTTATTCTTGACAGATTATACAATTTCAGCAACACAGGTTTACCCGACCCTACACTCAACACTACTTACCTCCAAACTCTTCGTGGACTATGCCCC
CTTAATGGCAATCGAAGTGCCTTGGTAGATTTTGATCTACGTACGCCTACGGTTTTCGACAACAAATACTACGTGAATCTCAAAGAGCGAAAAGGTCTTATCCAGAGCGACCAAGAGTTG
TTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGAGCATATGCTGATGGCACACAAACATTCTTCAATGCATTTGTGGAGGCAATGAATAGGATGGGAAACATTACACCAACT
ACAGGAACTCAAGGACAAATCAGATTGAACTGTAGAGTTGTGAACTCCAACTCTCTGCTCCATGATGTGGTGGATATCGTTGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAAAGGAAAC TATTCGTTTG CTGTTCTAGA TAAAAGCCTT TAATTGAGAA AAAGAAAATG CCTCCAGCTT TGACCCGTTT TGCCTATAAA AGGATTCTCT AAGATATGGA CTTTCCTCAT  CTTCTCGGGT AAACAGAATC AACTAGTTTT GTTTTTCCTC TTTCAAAAAT GCATTTCTCT TCGTCTTCAA CATCGTCCAC TTGGACAATC TTAATCACAT TGGGATGTCT TATGCTTCAT  GCATCTTTGT CCGCTGCTCA ACTCACCCCT ACCTTCTACG ATAGGTCATG TCCTAATGTC ACTAACATCG TACGAGAAAC CATTGTAAAT GAGTTAAGGT CGGACCCTCG TATCGCTGCG  AGCATCCTTC GTCTTCACTT CCACGACTGC TTTGTTAATG GTTGTGACGC ATCCATCTTG TTAGACAACA CGACATCATT TCGAACAGAG AAAGATGCGT TTGGAAACGC AAATTCGGCT  CGGGGATTTC CAGTGATTGA TAGAATGAAA GCTGCGGTGG AGAGGGCATG CCCAAGAACC GTTTCATGCG CAGATATGCT CACCATTGCA GCTCAACAAT CTGTCACTTT GGCAGGAGGT  CCTTCTTGGA GGGTTCCTTT GGGAAGGAGA GACAGTTTAC AAGCATTCCT GGAACTCGCT AATGCAAATC TTCCAGCTCC ATTCTTTACA CTTCCACAAC TTAAAGCCAG CTTCAGAAAT  GTTGGTCTCG ATCGTCCTTC TGATCTCGTT GCTCTCTCCG GTGGTCACAC ATTTGGTAAA AATCAATGTC AGTTTATTCT TGACAGATTA TACAATTTCA GCAACACAGG TTTACCCGAC  CCTACACTCA ACACTACTTA CCTCCAAACT CTTCGTGGAC TATGCCCCCT TAATGGCAAT CGAAGTGCCT TGGTAGATTT TGATCTACGT ACGCCTACGG TTTTCGACAA CAAATACTAC  GTGAATCTCA AAGAGCGAAA AGGTCTTATC CAGAGCGACC AAGAGTTGTT CTCTAGCCCC AATGCCACTG ACACAATCCC CTTGGTGAGA GCATATGCTG ATGGCACACA AACATTCTTC  AATGCATTTG TGGAGGCAAT GAATAGGATG GGAAACATTA CACCAACTAC AGGAACTCAA GGACAAATCA GATTGAACTG TAGAGTTGTG AACTCCAACT CTCTGCTCCA TGATGTGGTG  GATATCGTTG ACTTTGTTAG CTCTATGTGA GAATTGTTTA CCCAATATGT GGCTACAAGA ATACATATAT ATTAATGAAT AAAACTCTCA AGACGTTTAC TTGAGAACAT TTATTTTAGT 

Retrieve as FASTA