Entry information : AtPrx35 (At3g49960 / PER35 / AtperoxP35 / ATP21a / Atatp21A / AtP21)
Entry ID 201
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtPrx35 (At3g49960 / PER35 / AtperoxP35 / ATP21a / Atatp21A / AtP21)
Name (synonym) AtPrx35 (At3g49960 / PER35 / AtperoxP35 / ATP21a / Atatp21A / AtP21)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Callus
Mixed tissues
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx35
start..stop
S start..stop
CagraPrx07 646 0 1..329 1..329
CrubPrx102 642 0 1..329 1..329
AlyPrx35 639 0 1..329 1..329
BstrPrx76 634 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18525395..18525610 216 N° 2 18525106..18525306 201 N° 3 18524814..18524979 166 N° 4 18524313..18524719 407
complement(join(18524313..18524719,18524814..18524979,18525106..18525306,1852539 5..18525610))


exon

Literature and cross-references AtPrx35 (At3g49960 / PER35 / AtperoxP35 / ATP21a / Atatp21A / AtP21)
Protein ref. UniProtKB:   Q96510
DNA ref. Phytozome 12:   Chr3 (18525610..18524313)
Cluster/Prediction ref. Phytozome Gene 12:   19664084 UniGene:   At.19626
Omic ref. ePlant:   At3g49960 TAIR:   At3g49960
Protein sequence: AtPrx35 (At3g49960 / PER35 / AtperoxP35 / ATP21a / Atatp21A / AtP21)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   35619.33 (32915.9)  
PI (pH):   %s   9.49 (9.78) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFDIVLLIGLCLIISVFPDTTTAQLSRGFYSKTCPNVEQIVRNAVQKKIKKTFVAVPATLRLFFHDCFVNGCDASVMIQSTPKNKAEKDHPDNISLAGDGFDVVIQAKKALDSNPSCRNKVSCADILTLATRDVVVAAGGPSYEVELGRFDGLVSTASSVEGNLPGPSDNVDKLNALFTKNKLTQEDMIALSAAHTLGFAHCGKVFKRIHKFNGINSVDPTLNKAYAIELQKACPKNVDPRIAINMDPVTPKTFDNTYFKNLQQGKGLFTSDQVLFTDGRSRPTVNAWASNSTAFNRAFVIAMTKLGRVGVKNSSNGNIRRDCGAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns), 4 cDNA and 16 ESTs. Mainly from roots.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATGCTCACG CAGCTCAAAA CGATCGTTTC CAAGAAAATT TAAGCAATTC AGATTCTCCA GCACCAGCAA CAGCAGAAAA AACTCTTTCT CCTCCTGAGC TCAGCTCCTA CAAGAATGAA  CTCTCCAAAC TAAACCGGGA AAACCAATAC TTGAAGCTTG AGTTGCTCAA AGTGAAAATG AAGTTCAAGG AGTTGGAGAA GGAGAAAGCT TTTGAAGTCA TGAGTGGTTC GGATTGTTCT  TCTTCGGTTT CAACTGCTTC GGTGGCTAAG CCTCGATTAC CTAGAAAGTC ATTTATAAAC TCTGTTTCTC AAAAACTCGG AAAGCTTATT AACCCTTTTG GCCTCAAACA AGGACAAACC  AAACAACCTA AAAGCAGAAG ACACTCTATA TCTTAAACAA TACATGAACA CTTGTTCTTG TTGGAAATTT TCAATTTCTA GTCATGGATG TTTCTGTGTT GATTGTATAG AGAGCTGAGA  ATGTCTTTGA GTTTATGTGT TGAGTATAAT CTTTTTTTTG TCGACATTTT GTGTTGAGTA TAATCTTAAG AATCGTTAAG TCGTCATAGA GCAATTCTCA AAAAGTCAAC AGAAAATTTA  ATTATTCGGA TTAAAAAAAA AAAACTTAAT TTAGAAGACA CTCGAAGCAT GGGGAAGAAA GATACAAAGA GACTCTTCTT CTTTTCATCT TTTGTATTGT GGTAATCGGA AAATTTAAAG  TGGAAACGTG ATTTTAGTTA GGATCATTAG GGTTAGAGTT AAATGTGGGA TTTTATTTTT GATTTAGAAC TATCACAACC AAACCGTTAG GATTCCTACA AAAAAAAAAA CCAAACCGTT  AGGATTGAGG AAAAGGTTAA CCAAATAGTT GAACATAGAT TTTGGTTTGG TTTTGATCGG TTTAAATTCG GTTTTGGTTC CGTTTGCTTA GACTTTAGTT ACCGCAGATA TTATAATGGT  TTGACATTAA CAAAGTTGTC AACACAAACA AGGAGCGTGC CTTGCACAAT CTGCTCATAA TTGTTATTAA AGAAAAAGGG CATTGCTTTT CTCATAATTT CATGGCGTGT CAGAATGAAG  ATACAAATTC TATGTATGGT TTTGAGGGAT ATTACTGAAA CTTTTTTACT TATTACAAGT TTATCAATTA CTCCATATTA AGCATTGTGT GCGGAGTTCC ATTCTCATTT AATTTTGTTT  TCTATCGATT CAAATGTCTA TCAAGTATAA ACCAACAATC ACAATCTAAC CCATAAAACA GTCTAAAACC TCCATTTACT AAGTTAGAAA AAAACTCCTA TATAAAAGTA ACATATTATG  AAGAGAAAAA AAATGATGAG TCTTATAACA GTTAATGGTG AATACTACAA TTGTCTAAAC TAATTTTATT GTCAATTTAT TTTTCTTTTT ATAATTTATT TATATGGTTC ATTTACATGT  ACTACAATTA TTCTTATATA TTTTTCATTA TGATGCTCTC ACTAACTTTC ATCAGTTCAT GTAACAACGT GCAAACCACA TCTCCACTTT CAGTATTTGG ATTCCACTTT CATGTTTCGA  CGATCCATAT TTGTATTATT GTTGGCAATC CACATTTACT TTTTTCACTA GATAAATCCA TAATCACATA TTTATACAAT TAATCATTTT AGTATACAAT TAATTAAGGT TAATTAAACT  TGCTATTGTT ATTTATATTT CATTCTCACT GAAGAACTCT TCGTTGATGA TTTTCCACTC TTGTAAGAAG TACATCATGC TAACAAGTAT AAATGAAATG AACAAGGTAG GCCTGGTGCA  GTTAACCAAA AATCGAATAA TTTTATCAAA AGCCTATACT AAAACAAATG AATCTTCTTT AATATTGCGT TATATTCTTC AAGCCCATCA TTATATAAAC CTTTATCGTG CACCTTTTAC 
CGTCATCATT TCAAAAGCAA TTCTTCTTGT CTTGGCTCAA TTTATATACA ACACTCTCTC TCTCTCGGTT TTGTCCATAC A 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGCTGGTAAT GGGAAAATAT AAGTTGTCTT ATCTCCTATT TTCCTTTCGT TTTATTAATG TTTGAATGTT CATTTTGACG ATGAGAAGAT ATTATTGGTT TTTCATTTGT TTTGTTTATG  TCTTCATTTT AAGAAGGCAA TTGTATCTGA TCCTCTCTAC TTTGTATCTC CAACATGTTT ATTCTCGCTA CAAATTTAAA TAACTATATA CTATTCAATT TTTCCTATTA TAATAAGTTT  TCACTGTTAT CACTAAGCCT ATTCACGGAA AAATATCTAT GTAAACTAAA AGTGCTTATG AAGATGTAAA ATATGTTTAG TCATAATAAC GATTATTTTT CAACGTTAGA ATGTTTTGAA  CTAGTACAAA ACAATTGACA CTAGATTAGA ACAAAAAAAA AAGTTAATAA AAAATATTAT TAAATTGTAA TTAGATCAGA AATTAAAGCA ATGCTATTCT ACTATATTAG GTATCCAATT  AAAACGCTAA TTAAATTAAA TCAACCTGAT TTAAATGGGA ACCCAAACGG TAGCAAACAC AACACTATGA CCTTTCCACG TCAGCACGAG ACTCTCGTCG TCGTCTTCCT TCTTCATTCC  CCACCCGACA GCGTGCTCCT CCAGCATCGC CTTCACATCC GCCACCGCAT CTTCTTTAAC CCTAACTCCA CCGAACTCAG CCTCTCTCAT TCTCTCTATC CACCGTCTCT TCGTCTCCGT  CCTCTCCACT CTCTCCGCAC CTTCCTTCGC CACCACGTTT TCTATCTTCC AACTTATCTC CGCCTCGTAC CACCGTCTCT GCTCACTCAT AAACGTGTCC GTCGTATCGA ACGGAATCCA  GAAGTAGTTA AACGCCGATT TTAACCGGTT AACCAAGTTC TCCGATGTGA GATCTACGTC TTCTTCGATT AGGGTTACGA TTCTTGGATT CAAAGATCGG AGTTGTTTCA AGAAAACTGT 
TCGGAGCGAT GATGATGATG AAGTTAGGGG TTCTTCAGGG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCTTCGATATTGTTCTACTCATAGGTCTTTGCCTCATAATCTCTGTCTTTCCCGATACAACCACCGCACAACTAAGCCGCGGTTTCTACTCCAAAACTTGCCCCAATGTCGAA
CAAATCGTGAGAAATGCTGTCCAAAAGAAAATAAAGAAGACATTCGTCGCCGTCCCTGCCACTCTCCGTCTCTTCTTCCACGACTGCTTTGTCAAT
GTATGTTTCTATTTAAGCGTTTTC
ATATCTTTTTTCTCCTCTTTCATTAGGCGATTAATTGGTACCTTTGGCGTAATTGGCATTGTAGGGTTGTGATGCATCTGTCATGATCCAATCAACGCCTAAGAACAAGGCAGAGAAGGA
TCATCCAGATAACATTTCGCTAGCTGGAGATGGATTTGATGTGGTGATCCAAGCTAAGAAAGCCCTTGACTCTAACCCTAGTTGCCGGAACAAGGTCTCATGTGCCGATATTCTTACTTT
GGCCACCCGAGATGTTGTTGTTGCG
GTGAGTATTTGTACTAGCCTTACTATAACCAGATAATTAATCCTAAACAAAATTTCACATTAATATTAGTATATCACATTGCTTGTTTAGAAATG
TTTTATATAACAAGGTTTTACGCATGTATAGGCTGGAGGACCGTCCTATGAAGTTGAACTTGGTAGGTTCGATGGTTTGGTATCAACCGCGTCAAGTGTCGAAGGGAACTTACCAGGACC
TTCGGACAATGTAGACAAACTTAATGCTCTTTTCACGAAAAACAAACTTACCCAAGAAGATATGATTGCTCTTTCAG
GTAAACCAAATTTAAATCAAAACATCTTATATAGTTATATGTA
TTTATATCACCAAGATGCATCGATGTCTAAACCGATAAATTCATAATGTAGCGGCTCACACCCTTGGATTCGCACATTGTGGCAAGGTCTTTAAAAGAATCCACAAATTCAACGGCATCA
ACTCCGTGGACCCAACTTTAAACAAGGCTTACGCTATTGAGCTTCAAAAGGCTTGTCCTAAGAATGTGGACCCAAGAATTGCAATCAACATGGACCCAGTCACGCCCAAGACGTTTGACA
ACACTTACTTCAAGAATCTTCAACAAGGCAAAGGTCTCTTCACCTCCGATCAAGTTCTCTTCACGGATGGTCGCTCTAGGCCCACCGTTAATGCTTGGGCCTCAAACTCTACGGCCTTTA
ACCGCGCTTTTGTGATAGCCATGACCAAACTTGGCCGTGTTGGAGTTAAGAATAGCAGCAATGGAAACATCCGTCGTGATTGTGGTGCGTTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCTTCGATATTGTTCTACTCATAGGTCTTTGCCTCATAATCTCTGTCTTTCCCGATACAACCACCGCACAACTAAGCCGCGGTTTCTACTCCAAAACTTGCCCCAATGTCGAA
CAAATCGTGAGAAATGCTGTCCAAAAGAAAATAAAGAAGACATTCGTCGCCGTCCCTGCCACTCTCCGTCTCTTCTTCCACGACTGCTTTGTCAAT
GGTTGTGATGCATCTGTCATGATC
CAATCAACGCCTAAGAACAAGGCAGAGAAGGATCATCCAGATAACATTTCGCTAGCTGGAGATGGATTTGATGTGGTGATCCAAGCTAAGAAAGCCCTTGACTCTAACCCTAGTTGCCGG
AACAAGGTCTCATGTGCCGATATTCTTACTTTGGCCACCCGAGATGTTGTTGTTGCG
GCTGGAGGACCGTCCTATGAAGTTGAACTTGGTAGGTTCGATGGTTTGGTATCAACCGCGTCA
AGTGTCGAAGGGAACTTACCAGGACCTTCGGACAATGTAGACAAACTTAATGCTCTTTTCACGAAAAACAAACTTACCCAAGAAGATATGATTGCTCTTTCAG
CGGCTCACACCCTTGGA
TTCGCACATTGTGGCAAGGTCTTTAAAAGAATCCACAAATTCAACGGCATCAACTCCGTGGACCCAACTTTAAACAAGGCTTACGCTATTGAGCTTCAAAAGGCTTGTCCTAAGAATGTG
GACCCAAGAATTGCAATCAACATGGACCCAGTCACGCCCAAGACGTTTGACAACACTTACTTCAAGAATCTTCAACAAGGCAAAGGTCTCTTCACCTCCGATCAAGTTCTCTTCACGGAT
GGTCGCTCTAGGCCCACCGTTAATGCTTGGGCCTCAAACTCTACGGCCTTTAACCGCGCTTTTGTGATAGCCATGACCAAACTTGGCCGTGTTGGAGTTAAGAATAGCAGCAATGGAAAC
ATCCGTCGTGATTGTGGTGCGTTTAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCATTTCAA AAGCAATTCT TCTTGTCTTG GCTCAATTTA TATACAACAC TCTCTCTCTC TCGGTTTTGT CCATACAATG GCTCGCTTCG ATATTGTTCT ACTCATAGGT CTTTGCCTCA  TAATCTCTGT CTTTCCCGAT ACAACCACCG CACAACTAAG CCGCGGTTTC TACTCCAAAA CTTGCCCCAA TGTCGAACAA ATCGTGAGAA ATGCTGTCCA AAAGAAAATA AAGAAGACAT  TCGTCGCCGT CCCTGCCACT CTCCGTCTCT TCTTCCACGA CTGCTTTGTC AATGGTTGTG ATGCATCTGT CATGATCCAA TCAACGCCTA AGAACAAGGC AGAGAAGGAT CATCCAGATA  ACATTTCGCT AGCTGGAGAT GGATTTGATG TGGTGATCCA AGCTAAGAAA GCCCTTGACT CTAACCCTAG TTGCCGGAAC AAGGTCTCAT GTGCCGATAT TCTTACTTTG GCCACCCGAG  ATGTTGTTGT TGCGGCTGGA GGACCGTCCT ATGAAGTTGA ACTTGGTAGG TTCGATGGTT TGGTATCAAC CGCGTCAAGT GTCGAAGGGA ACTTACCAGG ACCTTCGGAC AATGTAGACA  AACTTAATGC TCTTTTCACG AAAAACAAAC TTACCCAAGA AGATATGATT GCTCTTTCAG CGGCTCACAC CCTTGGATTC GCACATTGTG GCAAGGTCTT TAAAAGAATC CACAAATTCA  ACGGCATCAA CTCCGTGGAC CCAACTTTAA ACAAGGCTTA CGCTATTGAG CTTCAAAAGG CTTGTCCTAA GAATGTGGAC CCAAGAATTG CAATCAACAT GGACCCAGTC ACGCCCAAGA  CGTTTGACAA CACTTACTTC AAGAATCTTC AACAAGGCAA AGGTCTCTTC ACCTCCGATC AAGTTCTCTT CACGGATGGT CGCTCTAGGC CCACCGTTAA TGCTTGGGCC TCAAACTCTA  CGGCCTTTAA CCGCGCTTTT GTGATAGCCA TGACCAAACT TGGCCGTGTT GGAGTTAAGA ATAGCAGCAA TGGAAACATC CGTCGTGATT GTGGTGCGTT TAACTAGAGC TGGTAATGGG  AAAATATAAG TTGTCTTATC TCCTATTTTC CTTTCGTTTT ATTAATGTTT GAATGTTCAT TTTGACGATG AGAAGATATT ATTGGTTTTT CATTTGTTTT GTTTATGTCT TCATTTTAAG 
AAGGCAATTG TATCTGATCC TCTCTACTTT GTATCTCCAA CATGTTTATT CTCGCTACAA ATTTAAATAA CTATATACTA TTCAATTTTT CCTATT 

Retrieve as FASTA