Entry information : AtPrx36 (At3g50990 / PER36 / AtperoxP36)
Entry ID 202
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-09-08 (Christophe Dunand)
Sequence status complete
Reviewer Harold Duruflé
Last annotation changes 2016-06-29 (Harold Duruflé)
Peroxidase information: AtPrx36 (At3g50990 / PER36 / AtperoxP36)
Name (synonym) AtPrx36 (At3g50990 / PER36 / AtperoxP36)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flowers
Seeds
Siliques
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx36
start..stop
S start..stop
AlyPrx36 665 0 1..343 1..340
CagraPrx19 608 0 6..343 2..335
CsativPrx36 607 0 6..344 2..338
CrubPrx36 605 0 12..343 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18943155..18943412 258 N° 2 18943508..18943699 192 N° 3 18943780..18943945 166 N° 4 18944187..18944605 419
join(18943155..18943412,18943508..18943699,18943780..18943945,18944187..18944605 )


exon

Literature and cross-references AtPrx36 (At3g50990 / PER36 / AtperoxP36)
Literature REFERENCE 1Ranocha P, Francoz E, Burlat V, Dunand C. Expression of PRX36, PMEI6 and SBT1.7 is controlled by complex transcription factor regulatory networks for proper seed coat mucilage extrusion. Plant Signal Behav. 2014;9(11):e977734.

REFERENCE 2 Kunieda T, Shimada T, Kondo M, Nishimura M, Nishitani K, Hara-Nishimura I. Spatiotemporal secretion of PEROXIDASE36 is required for seed coat mucilage extrusion in Arabidopsis. Plant Cell. 2013 Apr;25(4):1355-67.
Protein ref. UniProtKB:   Q9SD46
DNA ref. Phytozome 12:   Chr3 (18943155..18944605)
mRNA ref. GenBank:   NM_114959.3
Cluster/Prediction ref. Genebank:   824263 Phytozome Gene 12:   19663751 UniGene:   At.35434
Omic ref. AtProteome:   At3g50990 ATTED-II:   At3g50990 e-FP Browser:   At3g50990 ePlant:   At3g50990 Genevestigator:   At3g50990 TAIR:   At3g50990
Protein sequence: AtPrx36 (At3g50990 / PER36 / AtperoxP36)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   38113.43  
PI (pH):   %s   4.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNTKTVKSMAGIVLSQISLVALFPLCICYQTHQSTSSVASLSPQFYENSCPNAQAIVQSYVANAYFNDPRMAASILRLHFHDCFVNGCDASVLLDSSGTMESEKRSNANRDSARGFEVIDEIKSALENECPETVSCADLLALVARDSIVICGGPSWEVYLGRRDAREASLIGSMENIPSPESTLQTILTMFNFQGLDLTDLVALLGSHTIGNSRCIGFRQRLYNHTGNNDPDQTLNQDYASMLQQGCPISGNDQNLFNLDYVTPTKFDNYYYKNLVNFRGLLSSDEILFTQSIETMEMVKYYAENEGAFFEQFAKSMVKMGNISPLTGTDGEIRRICRRVNHDV

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns), 2 cDNA and 4 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTATGGAGAA ACTACCAGGT CATCATGGGT CACATCAAAC TGGGACTAAC ACGGCTTATG GTACTAACAC TAATGTCGTT CACCATGAGA AAAAAGGTAT AGCAGAAAAG ATTAAAGAGC  AACTGCCAGG TCATCATGGA ACTCACAAAA CTGGAACCAC CACAAGTTAT GGTAATACTG GCGTTGTTCA CCATGAAAAT AAAAGTACGA TGGATAAGAT TAAAGAGAAG CTTCCCGGTG  GTCATCACTA GATTGATTAA CAACTTGTTT AAGCTTATTT TAAGTATTTG TGTGGTGTAA TAATATGATG ATGTGGCTTT CTTTCATTGA GTCGCTAAAT AATATATGTA AGTGATGGAT  CTTTGAATTA ATATAAAATA TCTACTTCTG GTTTCGTTTA TTTATCTTTC TATCGCTTCA ACTATTCCAT GTTATTAAAA TACTTGTGAG TTGTGACACA TACAACCACG TATAATTCAC  ATGTAATTAT TTGGTAATTC AATTCTTTAC AAGTTTATAT GTTCTTTTGC ATACAAGTTA TCAGGGAAAC GACCGCAGTT GTTTGGCAAT GTATATTACT CAGGTTTTCA ATTCAGGCCC  ATACGGCCCA AATAAGTTGT TTTTACGGAT ATCGAGTTAA AAGAGGTGTG TCGATTATAA CGGACATGTG TCACACTAAC CACAAAACCA ACGTCTTACG TAATCGCCAC GTGTGTCACT  TCAACGCAAT TTGATAATAA TCATAATACT ATATGTGATT ATGATCCCTA TCCAAAGTTG CGGTTCTATA AAAATACCAT TCAAGAGCGT ATACATCTTT ATCCATCAGT GTCTTAATTT  TGTCTATAGC TAAAAAAAGG TTCAATTGTA AAAGGAATAT GGAGTCTTAC CAAAACCAGT CCGGAGCGCA GCAGACTCAC CAACAGCTTG ACCAATTTGG AAATCCATTT CCAGCCACCA  CCGGAGCCTA TGGAACTGCC GGTGGAGCTC CAGCCGTGGC TGAAGGTGGT GGTTTAAGTG GCATGCTTCA CCGTTCTGGG AGTAGCTCTA GCTCTAGCTC GGTATGCTTC TGTTTTACGC  AATTGCTTTT GCAATATTTA GTGTACTCTT TCTATATCAC CAAATACAAG AAGTTTCATT TAATTTGACT TCACCTAACT AGAAAAAATC AGGAAACCAT ATTTTAGATT TAACTCTACA  TATTTTTTAT AAACCATTTT TTGTGTTCAA ATGATAAGTT TTTGTTTGTA ATTTGAATTA TATTCAAGGT ATACCATATA TTTAAAATTA CTAAATAAAA TATGGAAAGT GTTGCAAATA  CATATAGCTT TTTAATTTTT CTGACGATTT TCATGCATGA AGGAGGATGA TGGACTAGGT GGAAGGAGGA GGAAGAAGAA GGGAATAACG GAGAAGATTA AAGAGAAGCT GCCGGGTCAT  CACGACTCCA ACAAGACTTC TTCTTTAGGT TCTACAACGA CGGCCTATGA TACCGGCACC GTTCACCACG AGAAGAAAGG CATGATGGAG AAGATCAAAG AGAAGCTTCC GGGTGGTCAT  CATTAGTTTC ATTTTAATTA ACTTGTTTGG TGTGGGTCGT TACGCTTATG GTCGTTGCAT GGAATAAATT ATAAACCCTC TCTTTTTCGT AACATTTATG GCTCAGGCTC TATTGTTTTG  AGTGATACAA ATTAAGGTAA TGTTAGCACA CGGGTGGGTT CACGATTCTA ATCGACATCT TCCCATTTAA AATAACAAAG GGATTTTGAC GTTTTCTATT CCCAACACAA AGGAAGACAA  AAGAAGGAGT GAAAATCGGT AACTATATAT AGATGTAACG AATCTTATAT CCAAACCAAC ACTCACAATT AATGTATCCC CCCATCCAAC AAATTAAAAG CCACGTTGAC GTGACAAATC 
ATACTTGGTG ACGCCTTCCT CTATAAATTA TCCAACCATG CATTCATCGT CATTCCCACA ATAATCGCTG AGAGTCCAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAGAGTTTCC ATTATTGGAT AGTTAAAAGT CCTAAGCGTT TGGTTAACGA CTTAACGTTA ATCTTTTTTT TTTTTTGTTA AATTTGATTT CTGTTGCCAT TGTGTTTAAT TTATTTTTAT  TTGTTCTAAT TAATTTATGA GTTTGGTGAT TGTATGGTAT ACCAAAACGT CAAAAACATA ACGATTTTTA TGGCAACTGA AATTGCTAAT GAATTTGGAA TGTGATGTGC CTATACTCAA  CAATACAAAT TTTGACGTGA CAACTCCATT AGGTGAAATA TCTTTCTCGA AATTATGGAT GTAACTTAAA CATCTAAACT AGAAGTATCG GAATGTTTTT AAGAGGCCCT AGAAACATAA  GGAGTGATGT TGTAAAGGAG TTTTGTTTTG TTGTTAGAAA ATTTCAAAGT GGAAGTGAGA CACATGAACA AATTTGTCGC ACTTTTACAA GTTGTGTTCT GGAGTAAACT TTACACTCTT  GGCTTTTGTT CAAAGAAGCA CATAAAAAAG CTTTAGACCT TTCTTTACTT TAAGAACCAT TATTATTGCC GAGATCACAC TCGGGTTTCG TTCTTGAATA CACATTATTA GTAGTTTAAT  TAAGACTAGA GCATCATGGT TCTTCTATAA GGCCACAGAG AACGGTATGA TTTTACTCTG TTTTGCTTAA CTTGTTTAAG AAAGAGAGAA TCTCTTGAGA GACTTGTTCA GACTTCTCCT  GCTGGATAAA ATGATGACCA CCTTCAATAA CAACTATCTC AAGATTAGGC ACAACAATCT TGAACACCTC TCCTTTCACA TACTCCATTG TTCCATTAGG TCCTTCATAT CCGATATCTT  TGTCTCCCGC TATAAACTTA GTAGGAACGA CGATTTTGGA GTCTTGCCAC GGCGCCAATA TCTCCCAATT CCTGTCACAT TGCACATTTT CAATACTTGT TTTTGTAACA ACAAAGACTG 
GAGATAAAGT GAGAGAGGGA AGTGAACAAC TTACATATCC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATACAAAAACGGTGAAGTCAATGGCGGGCATTGTTCTCTCTCAAATCTCACTTGTTGCGCTGTTTCCTCTATGTATTTGTTATCAAACACATCAAAGCACGAGCTCTGTAGCCTCT
CTATCCCCTCAGTTTTACGAGAACTCGTGCCCAAACGCACAAGCCATCGTTCAATCTTACGTCGCCAATGCATACTTCAATGACCCTCGCATGGCTGCCTCAATTCTTAGGCTCCATTTC
CACGACTGTTTCGTCAAT
GTTTGACAAAATCTAGTCTATTCTTCAGATATATAATGTTTTGATTTAAATAAGGAGAAATGTTGTTTGATATATATATACTCTGGTTGGTGCAGGGATGTG
ATGCTTCCGTACTATTGGACAGTAGTGGAACCATGGAAAGCGAGAAACGATCAAATGCAAATCGAGACTCTGCTCGAGGGTTCGAAGTCATTGACGAGATCAAGTCTGCCTTGGAAAATG
AATGTCCTGAAACAGTTTCTTGCGCCGATCTATTGGCTCTCGTTGCTAGAGACTCTATTGTTATT
GTAAGTCAATTCTCTAACACAATCATTAGGATTGATATATAATTGATACAAACAC
TCGTTACTTTTGTAATTATCTACAGTGTGGTGGACCTAGTTGGGAAGTATATCTTGGAAGAAGAGATGCAAGAGAAGCAAGCTTGATTGGTTCCATGGAAAACATTCCTTCTCCCGAGTC
CACGTTACAAACAATTCTCACTATGTTCAACTTTCAAGGACTTGATCTCACCGATCTTGTTGCCCTCTTAG
GTATATATACTACACTCGTCCAAGATATTAATGTGGTTGAATTTAAAGG
GGTCTTAAAGCAATTGTGATTTTATGGAAGAAACTAATTAAAAGTATAAATAAATGTTAATAACGATGTTTGTGATTGGATAAGAAAAGTTATCTTATCTCTCTATTAAAGATTAAATGC
CCTAAAAACTAACACATTGATAAATTTAATTATCATTTCTAAATTGAACTAATAACCATGATTCAAATGTAGGGAGTCACACGATAGGAAACTCAAGGTGTATTGGTTTCCGACAAAGGT
TATACAACCATACTGGAAACAACGATCCCGACCAGACTTTGAATCAAGACTACGCCTCTATGTTGCAGCAGGGATGTCCGATTTCGGGCAACGACCAGAACCTCTTTAATCTTGACTATG
TGACGCCGACTAAGTTTGACAATTACTACTACAAGAATCTTGTGAACTTTAGAGGACTCTTGAGTTCTGATGAGATATTGTTCACGCAAAGCATAGAGACTATGGAGATGGTCAAGTATT
ACGCGGAGAATGAGGGAGCGTTCTTTGAGCAGTTTGCGAAGTCGATGGTGAAGATGGGGAACATCTCACCGTTGACGGGGACGGATGGTGAGATCCGGAGGATATGCCGGAGGGTTAACC
ATGATGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATACAAAAACGGTGAAGTCAATGGCGGGCATTGTTCTCTCTCAAATCTCACTTGTTGCGCTGTTTCCTCTATGTATTTGTTATCAAACACATCAAAGCACGAGCTCTGTAGCCTCT
CTATCCCCTCAGTTTTACGAGAACTCGTGCCCAAACGCACAAGCCATCGTTCAATCTTACGTCGCCAATGCATACTTCAATGACCCTCGCATGGCTGCCTCAATTCTTAGGCTCCATTTC
CACGACTGTTTCGTCAAT
GGATGTGATGCTTCCGTACTATTGGACAGTAGTGGAACCATGGAAAGCGAGAAACGATCAAATGCAAATCGAGACTCTGCTCGAGGGTTCGAAGTCATTGAC
GAGATCAAGTCTGCCTTGGAAAATGAATGTCCTGAAACAGTTTCTTGCGCCGATCTATTGGCTCTCGTTGCTAGAGACTCTATTGTTATT
TGTGGTGGACCTAGTTGGGAAGTATATCTT
GGAAGAAGAGATGCAAGAGAAGCAAGCTTGATTGGTTCCATGGAAAACATTCCTTCTCCCGAGTCCACGTTACAAACAATTCTCACTATGTTCAACTTTCAAGGACTTGATCTCACCGAT
CTTGTTGCCCTCTTAG
GGAGTCACACGATAGGAAACTCAAGGTGTATTGGTTTCCGACAAAGGTTATACAACCATACTGGAAACAACGATCCCGACCAGACTTTGAATCAAGACTACGCC
TCTATGTTGCAGCAGGGATGTCCGATTTCGGGCAACGACCAGAACCTCTTTAATCTTGACTATGTGACGCCGACTAAGTTTGACAATTACTACTACAAGAATCTTGTGAACTTTAGAGGA
CTCTTGAGTTCTGATGAGATATTGTTCACGCAAAGCATAGAGACTATGGAGATGGTCAAGTATTACGCGGAGAATGAGGGAGCGTTCTTTGAGCAGTTTGCGAAGTCGATGGTGAAGATG
GGGAACATCTCACCGTTGACGGGGACGGATGGTGAGATCCGGAGGATATGCCGGAGGGTTAACCATGATGTTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATAATCGCT GAGAGTCCAA ATGAATACAA AAACGGTGAA GTCAATGGCG GGCATTGTTC TCTCTCAAAT CTCACTTGTT GCGCTGTTTC CTCTATGTAT TTGTTATCAA ACACATCAAA  GCACGAGCTC TGTAGCCTCT CTATCCCCTC AGTTTTACGA GAACTCGTGC CCAAACGCAC AAGCCATCGT TCAATCTTAC GTCGCCAATG CATACTTCAA TGACCCTCGC ATGGCTGCCT  CAATTCTTAG GCTCCATTTC CACGACTGTT TCGTCAATGG ATGTGATGCT TCCGTACTAT TGGACAGTAG TGGAACCATG GAAAGCGAGA AACGATCAAA TGCAAATCGA GACTCTGCTC  GAGGGTTCGA AGTCATTGAC GAGATCAAGT CTGCCTTGGA AAATGAATGT CCTGAAACAG TTTCTTGCGC CGATCTATTG GCTCTCGTTG CTAGAGACTC TATTGTTATT TGTGGTGGAC  CTAGTTGGGA AGTATATCTT GGAAGAAGAG ATGCAAGAGA AGCAAGCTTG ATTGGTTCCA TGGAAAACAT TCCTTCTCCC GAGTCCACGT TACAAACAAT TCTCACTATG TTCAACTTTC  AAGGACTTGA TCTCACCGAT CTTGTTGCCC TCTTAGGGAG TCACACGATA GGAAACTCAA GGTGTATTGG TTTCCGACAA AGGTTATACA ACCATACTGG AAACAACGAT CCCGACCAGA  CTTTGAATCA AGACTACGCC TCTATGTTGC AGCAGGGATG TCCGATTTCG GGCAACGACC AGAACCTCTT TAATCTTGAC TATGTGACGC CGACTAAGTT TGACAATTAC TACTACAAGA  ATCTTGTGAA CTTTAGAGGA CTCTTGAGTT CTGATGAGAT ATTGTTCACG CAAAGCATAG AGACTATGGA GATGGTCAAG TATTACGCGG AGAATGAGGG AGCGTTCTTT GAGCAGTTTG  CGAAGTCGAT GGTGAAGATG GGGAACATCT CACCGTTGAC GGGGACGGAT GGTGAGATCC GGAGGATATG CCGGAGGGTT AACCATGATG TTTGAGAGAG TTTCCATTAT TGGATAGTTA  AAAGTCCTAA GCGTTTGGTT AACGACTTAA CGTTAATCTT TTTTTTTTTT TGTTAAATTT GATTTCTGTT GCCATTGTGT TTAATTTATT TTTATTTGTT CTAATTAATT TATGAGTTTG 
GTGATTGTAT GGTATACCAA AACGTCAAAA ACATAACGAT TTTTATGGCA ACTGAAATTG C 

Retrieve as FASTA