Entry information : AtPrx38 (At4g08780 / PER38 / AtperoxP38)
Entry ID 204
Creation 2006-07-27 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtPrx38 (At4g08780 / PER38 / AtperoxP38)
Name (synonym) AtPrx38 (At4g08780 / PER38 / AtperoxP38)
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx38
start..stop
S start..stop
AlyPrx38-1 667 0 1..346 1..346
AhalPrx37 664 0 1..346 1..346
AhalPrx27 655 0 1..346 1..346
AtPrx37 645 0 1..346 1..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5604153..5604359 207 N° 2 5607210..5607401 192 N° 3 5607481..5607649 169 N° 4 5607730..5608202 473
join(5604153..5604359,5607210..5607401,5607481..5607649,5607730..5608202)


exon

Literature and cross-references AtPrx38 (At4g08780 / PER38 / AtperoxP38)
Protein ref. UniProtKB:   Q9LDA4
DNA ref. Phytozome 12:   Chr4 (5604153..5608202)
mRNA ref. GenBank:   NM_116948
Cluster/Prediction ref. Phytozome Gene 12:   19645617
Omic ref. AtProteome:   At4g08780 ATTED-II:   At4g08780 e-FP Browser:   At4g08780 ePlant:   At4g08780 Genevestigator:   At4g08780 TAIR:   At4g08780
Protein sequence: AtPrx38 (At4g08780 / PER38 / AtperoxP38)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (324)
PWM (Da):   %s   37930.29 (35528.9)  
PI (pH):   %s   7.72 (7.24) Peptide Signal:   %s   cut: 23 range:23-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSSLIKLGFLLLLLQVSLSHAQLSPSFYDKTCPQVFDIVTNTIVNALRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFDVIDKMKAAIEKACPRTVSCADMLAIAAKESIVLAGGPSWMVPNGRRDSLRGFMDLANDNLPGPSSTLKQLKDRFKNVGLDRSSDLVALSGGHTFGKSQCQFIMDRLYNFGETGLPDPTLDKSYLATLRKQCPRNGNQSVLVDFDLRTPTLFDNKYYVNLKENKGLIQSDQELFSSPDAADTLPLVRAYADGQGTFFDAFVKAIIRMSSLSPLTGKQGEIRLNCRVVNSKSKIMDVVDDALEFASFM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns) and 3 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAAGAAACT TTCACTACAA AAACATTATT CGTAAACTAA AGAGAAGAAA AAATAACATT TTTTCTTTGT TTTGGTAAAT GATTTATGTT AATAGAGTGT TTTCTGGTAA TTCTAATTAA  ACTAATTAGA ATAATCTAAC TTTTACCCTA TTACAGTGTG CATTTTTTTG TTCCGTTTTT TTTATCAACA ATATTTAACA TAGAATCCAA CTACAACGTA TATATAAACA ATAAATTTGG  AATTCCATGA TATATATACC CTTGTATCGA AAAGAAAAAT CCATGAAAAC TATACTAACT ATTATCTTTA AAATACACAA TCTTTTTTCT TGCACTTTCA GAATAATACG CCAAACAGTT  GAAAGACATT AACAAAACGT TAAATCTCAT ACATTTTTTC AATTTAAAAA TTTATACTAA CTATTAATCA AAAAATTGTG AGTGTCTACC AGCATTTCAG ACCTTGGCAT TATCACCAAT  ACTAATAGTT CCGGAAGTTT TTCTATTTTC TTGGGTCTAT GTAAAGATAA ATTATTGACT TTGGAGAACA CTTTTTTTGG GTTCTTTAGT TCTAATTTTT CTTGGATCGT ACGGTATATT  TAGAAATCAC GGAATGAAAA ACTTCACGAG AATATTAATC GAGATCCAAG GAACATTCTC CCATTAACGG AAAACGAAGC CAATGTTTAG ACGTTAGCTC AATTGGAGCC AATGGCAGTT  AAATCGGTTA ATATAAATCC TTCAGGATAT CATTGTTTCA TTGATTACTC CTGTAAAGAA ACTGATAAGT TTTTGCGCAT GGGATGGTTT TATACATTAT CAAATACGGA CATCCAACCA  TGGGTGTTGC CAACCTACGT AGAAGTTTCA CATGTCTACA CACAAAAGTG GAAGCATTTG TCTAGGTAAT AAGATGTATG ATTGGCCAAA ACAAACGAAA AATGACGTTC TATACAAATT  ACTCAGATCT AGTGAAAATG GTAACTAATA AAATTGTCGA TAAAAAAAAA ACAAAAAATA AAAACAAAGA AAAAAAAACA AAAACAAAAA ATTATACTAA AATTAAATTT ACCCACATAT  ACCATTAATT AAAGCATTAC CTCGAATAGT AATAACGCCA AAAACAAAGG AATGTCGTCT CCTCACACTC TTTCGCTCCT CATTCCTTCT CTAAACATCT CCTATTCTCT CTTGACACCG  TTGATTCCAA ATCGAGTAGC TAGAATATAG TCACCGCTTT TTATGTGTGT TTGTCACTTT CAAACATCAA GTTCGTCATC ACGGTATAAT TATACCAAAA CTATAAGCTT TCGTTACGTT  ACTATACATA CCCGAACTCA AGTTTTTTCA TGTTCATACC CAAAATTGTA GATAATGTCG AAAATCTACA TTGATCGATC GTCAAATCAT TATCAAACCA TAAACAATGC CAAGTCATCT  CCTGAGTCAC ATATATATGA TGCGTCTAGC TAGAGCATTG TTGTTACTAT GTTGCATAAA AACGGTCGGT TCAATTCTTC ATTCTTCTCT TCTACTAATG TTGTTTTGCT CAATTTCTTA  CTCTAAACAC CTAGTTTTAC AAAAGAGGTC TAGTAACCTG TTAACACTAA AAAAAAACAT CCACAACTCT ATGTTTTTCT TCTCAAGTCA AACACTCTTG AACATTGTTA CTACTATGCT  TCTTATTAGA CATTCCAAGA AAAATTTAAT TATCACTTGT ATAGCATAGG AATCAAATTG AGCATTGACA ATTAAAGTGT TGTAGACTTT AAAACCTAGT AGCCGAAAGA AAAAAAACAG  ATGCTTTAAA CCACTTTGTA CAATTCCATA TGTAATAGAC TATTAACGTA TACACTACTT GAATAAAAAT ATCTCATAAT CCACAAAAGT AAAAGCCGCC AAGCTAGATT ATTCTGCCTA 
TATAAGGAAT CGTTACGAAG AAACCTAAAT TCACTCATAT CTAACCATAA CCAAAAACAT TCTCTTAGAG AGCAAAGAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGAAATGTTT TTCTCTAACA ATAAATAAAT CATCAATGTT GTCAAGATGT TTCTTTAACG TTACTTATTT ATAATCTATT AAATGTTGTG TACAAATACT ACCAAAGAAC AACGTGCAAC  TAAAAGTATA GGTGACAAGC TACTGTCTAA AGCTCAATGA TCATCTACAC CTAACCAATG ATGAAACAAT ACACCGAAGC AAACAGAGAA TGTAGAATTC AAATAAGGTG ATATGTTTCT  ACGCTTGTAA CTATATTGGC AACATTTCAC AACACCAATG GTTTCATCAG AGATCTATTG AGACTCGTTG CTGCAAAACA AAGAAGATGG ATATATAAGA CTTCTTTTGA TTAACCGTTT  GGTCCAACAG AAAAACAAGT TTGTGAAGTC TGTATTTTTA CCTTATCTAT TGGCATTTTT GTTCTCACTG AGTCAATCAA TGAAAAATCA ATATCTGCCA CGACAATGCC GGTCGAAACA  CGATCTGCAA CAGCAACAGA ATCAATCATT TCATTTTGGT AAGAAGAGAC TTTTGTGTTT CATAGATCAA GATATAGATG ATGCCTTTGA TCATTTCAGG ATTCTCACCA GGTAACCTTC  CAACTACAGT TCCCCACGGA TCAATGATCA GTGTGTCACC ATAACTTTCT CTTTTCTCAT TATGCTTTCC TGCTTGAGCA GCAGCTATGA CCTGACGATA AACCAAGCAC GGAAATCGAA  CAGAGACTGT TAATCACAAA TGCAATGAGA AGTTAAAGAG GGAGATAAGT GTATAATGAC ATACATAACA TTGAGTTTCA ATTGCTCGGG CTCGAAGAAG AATCTCCCAG TGTGCCTCCC  CAGTGACCTT GGTGAAAGCT GATGGTACTA GTAAAACCTG CAGAGCATTA AGACAGACAT TTTATACTCA AGTCTGTGCT TTTTTTCTGT AGGAACTCAG TTTTATCACA TTTTTGTTTC 
GTCGTTTTTT CGCAGAGTTT CGAAGCGCAC GTAATTTAGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTTGATAAAATTGGGATTTCTTCTTCTCCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTACGATAAAACATGTCCGCAAGTCTTTGATATTGTA
ACCAATACCATTGTCAATGCGCTGAGATCAGACCCTCGCATCGCTGCAAGCATCCTTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GTAAGATACCACCAGATTCGATATATTCATGTA
TATATTAAGTACTCTTTTGGTTCTTTGATGGTTTTATCCTAAAAAGTGAGAATGCTTTACGGATATAATCATATATATGAAAGTTGGCCAACTCTCTCCATTTGGGTGACACATCATCAC
ACAAGAAAATGACATGTGTCATTTTACATTAATTATAAAAAAAAAATTAGTACAACTAATTGAGGAAAAATCAAAAGTCTTTTGTTGTGTAAATTCTCTATTAATCTCACTCTTAAATGA
ATTTTCTAAAAACACTCAATAAATAAAAAATCATAACAATGTATAAAGTACTACTTTCATTCTATTCTAATTATTTTTTTAATTTTTTTTATCAATAGTTATTAATCCATAATGGCTAAA
ATTTACTTATGTTGTAGTTTAGATGTTTGCTACCTAACCTCATATTAATTTAGTAATTTTAGTTGGATATTTTCTTATTATTACGTTATGTGATTATGATTTATCATATGACCTTCTTTC
TGTTTATTTTTGTGCGTTCTAATAACTTCGTAACATTGATATACAATTTTTTCACGTAGTGGTCATCTGAGACATTAGACATACCCACACAAAAACACGAGACTCTATATGGCTATATGA
AAGGGAAGAGAATTAAAGTGTTGACTTAATTTACTAGCATATCATGATGTGGTTGGTGTAGTAGATGACAAAAGAATATATGGAATAAAAAATTGTTTGTTACAATTAAGTTAGGCAAGT
TTCAAAATACATAAGTAATATAACTACATATTAATATATCATATAATGTTGTTGTGTGTGTTCATGATAGTGAAATATTTGAATAATAGGTATATAAATATTTATATTATAATAAAATTG
ATATTTCGAATTATAGATAAATTTAATCATAGAAAATTATAACTATATAAAATATATATGAATTTATTAATTACACATTAACATACACACACAAATGAACATCAAAATCAACAAAAGACT
ATAATCATATATTCCGACAATTTTAAAAACAAAAACCCATGCGTAGCATGAGTGTTCATTTAGAATAACGAATTAACTAATAATAACAAATACGCAGGTAATATTATAAACATTGTATAT
ATAAAGATCATAAGTTTATATATTATCTATATGTGGTGTAATCATATGTATAAAAGTTGGTCAACTCTCTTCATATGAATGACACATCATCACTTAGTTTTTGCCTAATGTCCACTTAAT
AATTAATGTAAGTTAATGGTTTATGGTGATTTATTATTTAATTGTATATATTATAAAATTTTACATAATTAATTGTATCAAGAATAATTTTCTTTTATTTTGTATATCTTTTTCTTAAAT
TAAATTATTTAATTGATTTTCTCATACTCTTGGATATTTTTCCCTAATTTTTATAATTTTAAGTCAAAATATGATTAAATAATTGTATAGTGGATTAGCTCATAGTTTTTGTAGTTTGTT
CTTTTTCTATATAATATATGAAAAATGGTGAGAAGTACTTGAGAATTCTATCATCAAATTCTTGGACTCAAATCCTCTACCATTTTGTCTTATTGTTTTGGTTTAAGGTTAACACAGATG
AAAAAAAATTCTGAAAATAATGTTTACTGAGAAAAGATTTTGTAAGGAATCTAAATGCAAAATGCAAAAACAAATGTTGATTTATGGAGCTTAGTATCAAATAGGATTTTTGTCTTCTTG
CCTATTAAAAAACTAACCTAAAATCTTACATTTAAATACTTTTAAATTACGAAATATAAAGTGAAAGCCCGCACGTATTGCGGGTACTCATCTAGTTAACTTGAAATAAGGATAGACATT
TCGGTTAGTTCATTTAATGTCTAATTAATTAATTAACTTGAAATAAAGATAGATTAATTATATAATAAAAAAACTGAATATTGATACAGTTATTATCGTCACAATAAAACAATATTCAGT
CACAATAATTTTTTTATGACGAAAGTGAAACGTATTTTAGAATGTCACAATAAAATCGTCACAAATCCATAAAGGTCTTAAAAAGATCACAAGACGATTAACAACAGTAACAATTCGTCA
TTGATTGTGACGACGTTAATATAGTCGAATAAACAGACACAGTTCGTGACGCACGATACTGTCATAATTTTTGTCACAATTTTTTCGTAAAAATATTTGATTTCTTTTTGTCTTAATAAG
ATACTTAAAACTATAGATTTCTTTTGATTGTTTGGTTTTGAAATTTTGGCTTTCTTTTGGTTGATTAAAACAATAGGAAAAAAAAAACAGAAGTTAAATAAAAATTCAAAGTAACAAAAA
AAGTTATTTCTACATCTGAAAATTTATGCGTTTTTGGATAAATTATCTTTTTGGAAGTTTGATTTTGTTTGTTTTGACTATTTTTTGGTTCAATTTGGAGTGGCTATTATTTTCTATGGA
CCAACCAAACCACTTCTTACGGAAATTGAGATGACTATTTTATTATTACAACTCTATATAGATATTCCAGTGCTGTCTTATCTCAAGTGTCAGATTTTGTCGTCAAAGTAAAGTCAAAGA
TAAAATTCTCTTCGATTATTAGATAATAATTAGTGAACTCGTATCACAAAAAACAAATAGTGAACTCATATTTTTCTTTTTTGGATTATTAGATTACATAGATGTCTTTGATCAACAAAA
AAAAAATTACGTAGATGTTGTGGCGTAGTATAGTAGCGCATTAATAACTAGATTTACTATTTTTCTTGCGGTAAAAAGAGAAAAACAAATCAGTAGATGCAGGTAAAATATATCTATGTG
GAAGTATTAACTTGATCTAACACTAATTGACAATAAAAATATTTTGTTTGGATAAAGGGATGTGATGCATCGATATTGTTAGACAACACAACATCGTTTAGGACGGAGAAAGATGCGTTT
GGGAACGCTAATTCAGCTCGAGGTTTCGATGTAATCGACAAAATGAAGGCTGCCATCGAGAAAGCATGTCCTAGAACCGTTTCATGTGCTGATATGCTCGCCATCGCAGCTAAAGAATCT
ATCGTTTTG
GTATGCATCTTCTACTATGCTATCCAAATGGTTTTTGTAGACCATTTTGTTAATGTTTAACCAAATATGTTTACTTTAGGCGGGAGGTCCTTCATGGATGGTTCCAAATGG
AAGAAGAGACAGCTTAAGAGGTTTTATGGATCTTGCTAATGATAACCTTCCAGGTCCATCTTCTACACTTAAACAACTTAAGGATAGATTCAAAAATGTCGGACTCGACCGTTCTTCTGA
TCTAGTTGCTCTTTCCG
GTATGTTATTATCTCATTTGAAACATTTTCATCTTTATAGTTGTAATCACTAATAACTCTATATGACTATATTGGTTTAGGTGGTCACACTTTTGGCAAAAGC
CAATGTCAGTTCATAATGGATCGTCTTTACAACTTCGGTGAAACCGGTTTACCCGACCCAACCCTTGATAAATCTTACCTAGCCACACTAAGAAAACAATGTCCACGTAATGGAAACCAG
AGTGTCTTGGTAGATTTTGATTTACGTACACCAACACTCTTTGACAACAAATACTATGTGAATCTCAAGGAGAACAAAGGACTTATCCAAAGTGACCAAGAGTTGTTCTCTAGCCCTGAT
GCTGCAGACACTCTCCCTTTAGTTCGAGCATACGCTGATGGTCAAGGGACATTTTTCGATGCGTTCGTGAAAGCAATAATAAGGATGAGTAGTCTTTCACCTTTAACAGGGAAACAAGGA
GAAATAAGATTGAACTGTAGAGTGGTGAATTCGAAATCTAAAATCATGGATGTGGTAGATGATGCTCTTGAATTTGCCAGCTTTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTTGATAAAATTGGGATTTCTTCTTCTCCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTACGATAAAACATGTCCGCAAGTCTTTGATATTGTA
ACCAATACCATTGTCAATGCGCTGAGATCAGACCCTCGCATCGCTGCAAGCATCCTTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GGATGTGATGCATCGATATTGTTAGACAACACA
ACATCGTTTAGGACGGAGAAAGATGCGTTTGGGAACGCTAATTCAGCTCGAGGTTTCGATGTAATCGACAAAATGAAGGCTGCCATCGAGAAAGCATGTCCTAGAACCGTTTCATGTGCT
GATATGCTCGCCATCGCAGCTAAAGAATCTATCGTTTTG
GCGGGAGGTCCTTCATGGATGGTTCCAAATGGAAGAAGAGACAGCTTAAGAGGTTTTATGGATCTTGCTAATGATAACCTT
CCAGGTCCATCTTCTACACTTAAACAACTTAAGGATAGATTCAAAAATGTCGGACTCGACCGTTCTTCTGATCTAGTTGCTCTTTCCG
GTGGTCACACTTTTGGCAAAAGCCAATGTCAG
TTCATAATGGATCGTCTTTACAACTTCGGTGAAACCGGTTTACCCGACCCAACCCTTGATAAATCTTACCTAGCCACACTAAGAAAACAATGTCCACGTAATGGAAACCAGAGTGTCTTG
GTAGATTTTGATTTACGTACACCAACACTCTTTGACAACAAATACTATGTGAATCTCAAGGAGAACAAAGGACTTATCCAAAGTGACCAAGAGTTGTTCTCTAGCCCTGATGCTGCAGAC
ACTCTCCCTTTAGTTCGAGCATACGCTGATGGTCAAGGGACATTTTTCGATGCGTTCGTGAAAGCAATAATAAGGATGAGTAGTCTTTCACCTTTAACAGGGAAACAAGGAGAAATAAGA
TTGAACTGTAGAGTGGTGAATTCGAAATCTAAAATCATGGATGTGGTAGATGATGCTCTTGAATTTGCCAGCTTTATGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCT CTTTGATAAA ATTGGGATTT CTTCTTCTCC TTCTTCAGGT CTCATTGTCT CATGCTCAAC TAAGCCCTTC CTTTTACGAT AAAACATGTC CGCAAGTCTT TGATATTGTA  ACCAATACCA TTGTCAATGC GCTGAGATCA GACCCTCGCA TCGCTGCAAG CATCCTTCGT CTTCATTTCC ACGACTGCTT TGTTAATGGA TGTGATGCAT CGATATTGTT AGACAACACA  ACATCGTTTA GGACGGAGAA AGATGCGTTT GGGAACGCTA ATTCAGCTCG AGGTTTCGAT GTAATCGACA AAATGAAGGC TGCCATCGAG AAAGCATGTC CTAGAACCGT TTCATGTGCT  GATATGCTCG CCATCGCAGC TAAAGAATCT ATCGTTTTGG CGGGAGGTCC TTCATGGATG GTTCCAAATG GAAGAAGAGA CAGCTTAAGA GGTTTTATGG ATCTTGCTAA TGATAACCTT  CCAGGTCCAT CTTCTACACT TAAACAACTT AAGGATAGAT TCAAAAATGT CGGACTCGAC CGTTCTTCTG ATCTAGTTGC TCTTTCCGGT GGTCACACTT TTGGCAAAAG CCAATGTCAG  TTCATAATGG ATCGTCTTTA CAACTTCGGT GAAACCGGTT TACCCGACCC AACCCTTGAT AAATCTTACC TAGCCACACT AAGAAAACAA TGTCCACGTA ATGGAAACCA GAGTGTCTTG  GTAGATTTTG ATTTACGTAC ACCAACACTC TTTGACAACA AATACTATGT GAATCTCAAG GAGAACAAAG GACTTATCCA AAGTGACCAA GAGTTGTTCT CTAGCCCTGA TGCTGCAGAC  ACTCTCCCTT TAGTTCGAGC ATACGCTGAT GGTCAAGGGA CATTTTTCGA TGCGTTCGTG AAAGCAATAA TAAGGATGAG TAGTCTTTCA CCTTTAACAG GGAAACAAGG AGAAATAAGA 
TTGAACTGTA GAGTGGTGAA TTCGAAATCT AAAATCATGG ATGTGGTAGA TGATGCTCTT GAATTTGCCA GCTTTATGTG A 

Retrieve as FASTA