Entry information : PpePrx07 (ppa008390m)
Entry ID 2045
Creation 2005-09-26 (Christophe Dunand)
Last sequence changes 2011-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx07 (ppa008390m)
Name (synonym) PpePrx07 (ppa008390m)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue types Buds
Fruits
Mesocarp
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx07
start..stop
S start..stop
MePrx53 550 0 1..332 1..333
RcPrx16 540 0 2..332 5..334
GhPrx22 535 0 25..332 26..332
GmPrx71 528 0 5..332 3..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11093061..11093282 222 N° 2 11093382..11093576 195 N° 3 11093997..11094162 166 N° 4 11094261..11094679 419
join(11093061..11093282,11093382..11093576,11093997..11094162,11094261..11094679 )


exon

Literature and cross-references PpePrx07 (ppa008390m)
Literature Callahan,A., Palmer,M., Main,D., Wing,R. and Abbott,A. Peach Model Genome for Rosaceae. Unpublished (2002).
DNA ref. Phytozome 11:   scaffold_7 (11093061..11094679)
EST ref. GenBank:   AJ876321 [5' end]   GE653217.1 [3' end]   BU044759 [Fragment]
Protein sequence: PpePrx07 (ppa008390m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (306)
PWM (Da):   %s   35033.15 (32155.7) Transmb domain:   %s   i7-24o
PI (pH):   %s   4.76 (4.76) Peptide Signal:   %s   cut: 28 range:28-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSSSTTYSLPLAITFVLLMLYVSNAQLNTTFYSSTCPNVTTIVRSVVQQALQSDSRIGASLIRLHFHDCFVNGCDASILLDKGGSIQLSEKDAAPNTNSTRGFDVVDNIKTAVENSCPAVVSCADILALAAEASVSLSGGISWNVLLGRRDSLTANQAGANTSIPSPFEGLANITSKFSAVGLNTNDLVALSGAHTFGRAQCQRFSNRLYNFNGTGNPDPTLNSSYLTTLQQTCPQNGSGTALANLDPTTPDSFDNSYFSNLQNNQGLLQSDQELFSTTGAATVSIVNSFSSNQSAFFQSFAQSMINMGNISPLVGSNGEIRLDCKKVNGG

Retrieve as FASTA  
Remarks Complete sequence from genomic 3 ESTs. Cultivar="Fantasia".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTCTTCTTCAACAACTTATTCCTTGCCATTGGCAATCACATTTGTACTCTTAATGCTATATGTATCCAATGCTCAATTGAACACTACATTTTACTCTTCCACATGCCCAAAT
GTGACCACTATTGTCCGCAGTGTGGTTCAACAAGCTTTGCAATCTGACTCCAGGATTGGAGCTAGCCTTATTCGTCTTCATTTCCACGATTGCTTTGTCAAC
GTAAACACAATTAGCTTG
ATTTTTTTTTTCTCACACTTGTCTTAATTATTATCAGTTTTTTGATGTAGCTAGAACTCAAGTTTGTTAGTGCTATTTCAGGGATGTGATGCTTCAATCTTGCTAGACAAGGGTGGGAGC
ATACAGCTGAGTGAGAAAGATGCAGCCCCAAACACCAACTCCACTCGAGGCTTTGATGTTGTTGACAACATCAAGACTGCTGTGGAAAATTCTTGCCCTGCTGTAGTATCTTGTGCTGAC
ATTCTGGCCCTTGCTGCTGAAGCTTCTGTTTCTTTG
GTGAGTCAACAAGGCATGGTATCCAATTTTTAGTTACCAATCATGTGTTTGTGTATAACTCTTAAGCATATGTCCACAAATATT
TCAAAATTTTGAAATTTCCGGCTGTGAAATTGAAGCTCATTCAGTTGACTCAAAGGGTGTTTCGATTTTGAAATCAAGGAAATCGAATTAAAACCGCTTCAATATAGATTGAAAGGGTTT
TGGCTGTGAAATCTAAGCCCTTCCAGTTAACTAGAAAGAGTTTCGATTACGAAATCAAAGAATGAAGTCTAAACTGAAGCCCTTTGGGCTAAACCAAATGGGCTTTGATTTCACAACCGA
AGCCCTTCGAGCCAATCCAAAAAGGCTCGGATTTGATATATAGTGGAATCTTATAAAGGGCTCATGGCATAGACTTTAATTGACCTAAATTGGCAGTCAGGAGGTATTTCATGGAATGTA
TTACTGGGGAGAAGAGACAGTCTAACTGCAAACCAAGCTGGAGCCAACACCTCTATTCCCTCTCCTTTTGAAGGCTTAGCCAACATTACCTCCAAGTTTTCTGCTGTTGGCCTAAACACC
AACGATCTTGTTGCATTATCTG
GTAACTATGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACCCTTTTATAAATCAATCATGTTATTATCCAATGTTGCAG

GTGCACATACATTTGGGCGAGCTCAATGTCAAAGATTTAGCAACCGATTGTACAATTTCAATGGCACTGGCAATCCTGACCCAACTTTGAACTCTTCCTACTTGACCACTCTCCAGCAAA
CATGTCCACAGAATGGGAGTGGAACAGCTTTGGCCAACTTAGACCCCACAACTCCGGATAGCTTTGACAATAGCTACTTCAGCAACTTGCAGAACAATCAAGGTCTTCTGCAATCAGATC
AGGAGTTGTTTTCGACGACCGGGGCTGCAACAGTTTCTATTGTTAATAGCTTTAGCAGCAACCAGAGTGCCTTCTTTCAGAGCTTTGCTCAGTCAATGATCAACATGGGAAATATTAGTC
CATTGGTGGGAAGTAATGGGGAGATTAGGTTGGATTGTAAGAAGGTCAATGGAGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTCTTCTTCAACAACTTATTCCTTGCCATTGGCAATCACATTTGTACTCTTAATGCTATATGTATCCAATGCTCAATTGAACACTACATTTTACTCTTCCACATGCCCAAAT
GTGACCACTATTGTCCGCAGTGTGGTTCAACAAGCTTTGCAATCTGACTCCAGGATTGGAGCTAGCCTTATTCGTCTTCATTTCCACGATTGCTTTGTCAAC
GGATGTGATGCTTCAATC
TTGCTAGACAAGGGTGGGAGCATACAGCTGAGTGAGAAAGATGCAGCCCCAAACACCAACTCCACTCGAGGCTTTGATGTTGTTGACAACATCAAGACTGCTGTGGAAAATTCTTGCCCT
GCTGTAGTATCTTGTGCTGACATTCTGGCCCTTGCTGCTGAAGCTTCTGTTTCTTTG
TCAGGAGGTATTTCATGGAATGTATTACTGGGGAGAAGAGACAGTCTAACTGCAAACCAAGCT
GGAGCCAACACCTCTATTCCCTCTCCTTTTGAAGGCTTAGCCAACATTACCTCCAAGTTTTCTGCTGTTGGCCTAAACACCAACGATCTTGTTGCATTATCTG
GTGCACATACATTTGGG
CGAGCTCAATGTCAAAGATTTAGCAACCGATTGTACAATTTCAATGGCACTGGCAATCCTGACCCAACTTTGAACTCTTCCTACTTGACCACTCTCCAGCAAACATGTCCACAGAATGGG
AGTGGAACAGCTTTGGCCAACTTAGACCCCACAACTCCGGATAGCTTTGACAATAGCTACTTCAGCAACTTGCAGAACAATCAAGGTCTTCTGCAATCAGATCAGGAGTTGTTTTCGACG
ACCGGGGCTGCAACAGTTTCTATTGTTAATAGCTTTAGCAGCAACCAGAGTGCCTTCTTTCAGAGCTTTGCTCAGTCAATGATCAACATGGGAAATATTAGTCCATTGGTGGGAAGTAAT
GGGGAGATTAGGTTGGATTGTAAGAAGGTCAATGGAGGTTAA

Retrieve as FASTA