Entry information : AtPrx40(At4g16270 / PER40 / AtperoxP40)
Entry ID 206
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2020-03-04 (Christophe Dunand)
Peroxidase information: AtPrx40(At4g16270 / PER40 / AtperoxP40)
Name AtPrx40(At4g16270 / PER40 / AtperoxP40)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flowers
Inflorescences
Siliques
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx40
start..stop
S start..stop
AlyPrx40 720 0 1..362 1..362
AhalPrx40 714 0 1..362 1..362
BstrPrx61 688 0 1..362 1..362
CagraPrx20 658 0 15..362 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9205038..9205364 327 N° 2 9205564..9205755 192 N° 3 9205836..9206001 166 N° 4 9206080..9206483 404
join(9205038..9205364,9205564..9205755,9205836..9206001,9206080..9206483)


exon

Literature and cross-references AtPrx40(At4g16270 / PER40 / AtperoxP40)
Literature REFERENCE 1 Tsukagoshi H, Busch W, Benfey PN. Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell. 2010 Nov 12;143(4):606-16.
REFERENCE 2 Jacobowitz JR, Doyle WC, Weng JK. PRX9 and PRX40 Are Extensin Peroxidases Essential for Maintaining Tapetum and Microspore Cell Wall Integrity during Arabidopsis Anther Development. Plant Cell. 2019 Apr;31(4):848-861.
Protein ref. UniProtKB:   O23474
DNA ref. Phytozome 12:   Chr4 (9205038..9206483)
mRNA ref. GenBank:   NM_117724
Cluster/Prediction ref. Phytozome Gene 12:   19647397 UniGene:   At.50347
Omic ref. ePlant:   At4g16270 TAIR:   At4g16270
Protein sequence: AtPrx40(At4g16270 / PER40 / AtperoxP40)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (329)
PWM (Da):   %s   39088.19 (35017.0) Transmb domain:   %s   i17-34o
PI (pH):   %s   4.42 (4.18) Peptide Signal:   %s   cut: 34 range:34-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLKLRRKWSDHITTMKNLFNLFLMFFFAMPILSLSENPTNFSESCEDGSGETGSSFGIGFDLVLDFGLYRNSCPEAESIVYSWVETTVLEDPRMAASLLRLHFHDCFVNGCDASVLLDDTEGLVGEKTAPPNLNSLRGFEVIDSIKSDIESVCPETVSCADILAMAARDSVVVSGGPRWEVEVGRKDSRTASKQAATNGLPSPNSTVSTLISTFQNLGLSQTDMVALSGGHTLGKARCTSFTARLQPLQTGQPANHGDNLEFLESLQQLCSTVGPSVGITQLDLVTPSTFDNQYYVNLLSGEGLLPSDQALAVQDPGTRAIVETYATDQSVFFEDFKNAMVKMGGIPGGSNSEIRKNCRMIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns), 6 cDNA and 4 ESTs. Related to flowers
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCGGTTAGC AAGTCCGGGC ATTAAGCTAA AGATCCCATA CAGAGATTCA TCTAGAATGG TTTTCAGTAG CTAACAAAGG CATAATGCTT TGTAATAACA AAACATAACA CAAACAGTAG  AAACAAAAAA AAACTCAGAT TCGGTAACAC CAATGGATAT TGTTGAAACT CAAATGGTTT TAGAAGTTAA GTTGCAGAAA CCCTCTAAAC GGTTTTTAAA AGGTCTTGCG TTTGTTCAGA  AGTTCTCAAA GAACTCTTTA TACTGATAAG CACTACTATC TTAACCAATC AGATTCATGA TATGAGAGAC AAGGAAAATG ATCTAAACTC ATTAAATTAT CATTCCTTGG TTTACTTCAA  GTTCAGACAT TCGACCTTTA ACCGTATAAG CGATTACAAA GAGTAAAACA TCAGAGCTTA AATAAATATC AACACAAATC ATATACAAGT GAACAACTAA AGTCTATTGG TTTCAGCCCT  AGCTTTGTTT CAACACCACA TTGTTCCATT AACACTAAGG AAACCTAATT TTATAAAAGA AAGCATAGTA AACAAAGTTT ACCTGGTGAT CACAATTACG GCACGCATAG AGGAGGATTG  ATTGCTCCTT GTCTTCCTTG GGATATAGAA TGTTATTACT GAACATTTCA AAAAAAAACA AAATCAAAGG TTCATAAGCT GCAAAAGTGG AGAAAAGTTG GAGCTTTAAT CCAATAGAAA  ACATAAGCAA ACCATCCAAA ACTAAAATTC CGACAATTAG AGACTTAAGA GAACTGGGTA CAATATATAA TTCAATATGA GCTAAGAAAT GAAAACCCAA ATTTCAATTT CAGAAGACTA  GTATAAAAGA GCAGAGAACA GATTCGTTTT GACCCCCAAA ATAAAAAAAA CGAAGAGATT CGTATTTACC ATTCGCGACA AAATTTCATA GTACTCATCT TCGCAGAATC TTTAGATAAC  GAGCTTTTGA ATGCTTCTTT GATTTCACAA TCAGTCTCTT CGTATCTTTG GCGGGATTTG TTCACTCGGA CATGAGAGAG AAGAGGTCAA GCTCTAGTAA AGACTAAAGA CTGCGTAGTG  GCAATCGGAT GTAATTTCAT GAACTTTCTC GGGCATTTAG ACAATAAATG CGTAAAGCCC ATGGGCCGGC CCATATCAGA ATTTAACTTG TGGGGTAGAA AAAAATACAA ATAAAGAAAT  ACGAAGAGGA CAATACGAAA TAAATTTGAC CCTTTCTTCA TTGAAGACTA GTGTACTTTT TCTTACATTA ACAACCACAT GCATATCCCC ATGCACCTTT ATATCATTGT GAAAATTATT  CGATATTCAT TATATAAGTT CTGTTCTATT AAAAATATGA AAGAAATTAA GCACATTATA TACTACTAAC TTCTGTCAGA TTCCAACTGC TGAATTGGTC TGTCTTTTAA CTACTCCTGA  CTCTATAGTG TATACCGACA CATCTCTCTA GCACTTGCAC TAGCACTAGC AATAGTAACA ACATGGTTTA TTTGTGTGTT TCCTCTTCAT TCATTACAAT ATCATTACTA CTCTTTTGTT  CCTTTTTATT ACAACTTACT AATAATAGCC ATTAGCCAGC CACCTTATGC AATCTTATCC CTTATCACGT ATATAGTTTA GTCCAAAACG TTTTGTTTTG CTCAAATAAT AATTCATGCA  TAAAAAACAA CAAAAAACAC ACAATTATAC ATGCTGATCA TAAATTGTAT TATGAGAATT TGTTAATCAT TTGGTATACT AACATTGCAA TTTTACTTGA ATATTTGCCA ATCTACTTCT  TTTATATATA CATACATTTA TTGACGTACG TATGATTAAT TTGACGAGTA CATAATATGT AATTGGGTTG TTGAAGTGCA CATGCAGTCA TGCAGTCACA CATACATATA TACGTGTTAT 
GTATGTGTAT ATAGTTGAAT TGTTTCTATA AATATGGACA CACATACACT AGCTTTCTAA TATAGTACCA ACTCCATTGA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAATAAAAGC CCGACTTATT GAATGATATC TAATTATCTA TATAAAAATT AAAGAAGTCC ACCTACGTAG GACTCTGATT TTACGTAATC ATTAGAAGAG CGAACACATA TATGAAGATC  AGGAAACTAC AAATTGATAG ATCTCTGAAA ATGACAATTA GAGTTGGATT TTGCTAAGAT CTAGTCTCAT TATAAGTGAT GAGCTATCTA TGAATGTACA TATTCTATTT ATATAATTAT  ATATGACTCC TAATCTGGAT CAAAGTTTGG TTTACCCAGC TAAGTTACTA CTAGTAACAC AACATGAGAC ATAACTTGCG CTAGCTATGT TACAACAGGC CATTGTTTGG CAGCTCTTAA  AATGAAAAAG GAGGAGATAT CTGATTAGAG AAAAGATAGA ATGCAGATGG TCTACGATCG CCTATCTATT ATAACTGAAG GGGTTAACTA AAAAAATCAG AGACTAAGGA CACTACCATT  GCTGCTTTTC CTCTCCTTGA CTAATTAGTT CCAGAAATTT CTATCTAGCT ACTGAGATAG TTTAGCTCCT CGTCTCATGT ACCTGAAGTA GAGTATCGAT CAACACAGAG GTAACTTCAA  CTAAAGAAAC CACATACATT GGAATGTGTT TCGGTATGGA GAAAATACAA GAGAGAGGAG AGAAAGGGTA GATATGAACC TCAAGCTTTA TTCTTCCACA TGAGTTCTTG GGGAGATTGA  CGGCTCTGGG AAAAAGAGAT ATGATTGTAA AGAGAATTAA GGAAAAAAAC GGTTTCAACG AAAAAGAACA TCTGAATACC AAAGGACGAA TTATGAACAG AGAGAAGTTC TGAATCACTG  ATAAAAACCA TAACTACCTG TTGAGTTCTT GATATATCAT TCATTGAAGC AGCTCCCACG GGTATATGTG TCCGAGCATA ATCCTAGACA ATCCAAACAG AATAGAAAAT AAGCTCTGCC 
TAAACCATTT TTAACCAAGG AAGGAAGTCA TATCACTGAT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTAAAACTCAGAAGAAAGTGGAGTGATCATATAACGACAATGAAGAATCTCTTTAACTTGTTCCTTATGTTTTTCTTTGCAATGCCAATTCTTTCACTCTCCGAGAATCCAACCAAT
TTCAGCGAGAGTTGCGAAGACGGGAGTGGAGAAACCGGTTCAAGCTTTGGCATAGGGTTCGATTTGGTTCTTGATTTTGGTTTATACCGGAATAGCTGCCCCGAAGCAGAGTCTATCGTC
TACTCGTGGGTGGAAACCACGGTGTTAGAGGATCCAAGAATGGCTGCTTCTCTTCTCCGTCTTCATTTCCACGACTGTTTTGTCAAT
GCAAGTCACATCTCATCTTAAGTTTGTTTTAAT
AGTTTTGGTCTATCATCTAATCCCCGTCTTTTATATACCATTGAACCGGGAAGGATTATATTATGTTAGTTAAACCGTGACAAATCTAAATTGTACCGGTTAAGTAGGGAATGAGTACTA
CGAACCAGAATGTGTTTTTGTTTTTGACTTGCATTATGCATTGCAGGGATGTGATGCTTCGGTGTTGTTAGATGACACAGAAGGACTGGTTGGTGAAAAAACGGCGCCTCCTAATCTAAA
TTCTCTACGAGGGTTCGAAGTGATTGATTCGATAAAGTCTGATATTGAATCTGTATGTCCAGAGACCGTCTCATGCGCAGACATTCTTGCCATGGCTGCTAGAGATTCAGTCGTTGTG
GT
AGTTATCATCATATTATAAAGTTGATGAACTCAATTCAAATCGTCTATGTTTAACATTTTTAAATCGGGTTTTTGAAGTCGGGTGGACCAAGGTGGGAGGTGGAAGTAGGAAGAAAAGAC
AGTAGAACAGCAAGCAAACAGGCAGCAACAAATGGCTTACCCTCACCAAACTCAACCGTATCAACTCTCATCTCTACTTTCCAGAATCTTGGCCTTTCACAAACCGACATGGTCGCTCTT
TCCG
GTATACATTCTCTTGTACTCTTCTTTATCTTTCTCTAGACCAACCCAAGTTATTGATACTTACACATATGGAAACCAGGTGGACATACATTGGGAAAGGCACGGTGCACTTCGTTT
ACAGCTCGGTTGCAGCCACTGCAAACTGGACAACCAGCTAACCACGGAGACAACCTTGAGTTCCTCGAGTCACTGCAACAGTTATGCTCGACTGTTGGGCCCAGTGTAGGTATCACTCAG
CTTGACTTGGTGACTCCATCAACATTTGACAACCAGTACTATGTAAACCTCCTCTCGGGTGAGGGATTGCTTCCATCAGACCAGGCTTTAGCGGTTCAAGACCCAGGGACAAGGGCGATT
GTTGAGACCTACGCAACAGATCAGTCGGTTTTCTTTGAGGATTTTAAGAACGCTATGGTTAAAATGGGAGGGATACCCGGTGGTAGTAATAGCGAGATTAGGAAGAATTGTAGAATGATT
AACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTAAAACTCAGAAGAAAGTGGAGTGATCATATAACGACAATGAAGAATCTCTTTAACTTGTTCCTTATGTTTTTCTTTGCAATGCCAATTCTTTCACTCTCCGAGAATCCAACCAAT
TTCAGCGAGAGTTGCGAAGACGGGAGTGGAGAAACCGGTTCAAGCTTTGGCATAGGGTTCGATTTGGTTCTTGATTTTGGTTTATACCGGAATAGCTGCCCCGAAGCAGAGTCTATCGTC
TACTCGTGGGTGGAAACCACGGTGTTAGAGGATCCAAGAATGGCTGCTTCTCTTCTCCGTCTTCATTTCCACGACTGTTTTGTCAAT
GGATGTGATGCTTCGGTGTTGTTAGATGACACA
GAAGGACTGGTTGGTGAAAAAACGGCGCCTCCTAATCTAAATTCTCTACGAGGGTTCGAAGTGATTGATTCGATAAAGTCTGATATTGAATCTGTATGTCCAGAGACCGTCTCATGCGCA
GACATTCTTGCCATGGCTGCTAGAGATTCAGTCGTTGTG
TCGGGTGGACCAAGGTGGGAGGTGGAAGTAGGAAGAAAAGACAGTAGAACAGCAAGCAAACAGGCAGCAACAAATGGCTTA
CCCTCACCAAACTCAACCGTATCAACTCTCATCTCTACTTTCCAGAATCTTGGCCTTTCACAAACCGACATGGTCGCTCTTTCCG
GTGGACATACATTGGGAAAGGCACGGTGCACTTCG
TTTACAGCTCGGTTGCAGCCACTGCAAACTGGACAACCAGCTAACCACGGAGACAACCTTGAGTTCCTCGAGTCACTGCAACAGTTATGCTCGACTGTTGGGCCCAGTGTAGGTATCACT
CAGCTTGACTTGGTGACTCCATCAACATTTGACAACCAGTACTATGTAAACCTCCTCTCGGGTGAGGGATTGCTTCCATCAGACCAGGCTTTAGCGGTTCAAGACCCAGGGACAAGGGCG
ATTGTTGAGACCTACGCAACAGATCAGTCGGTTTTCTTTGAGGATTTTAAGAACGCTATGGTTAAAATGGGAGGGATACCCGGTGGTAGTAATAGCGAGATTAGGAAGAATTGTAGAATG
ATTAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATATAGTAC CAACTCCATT GAATGTTAAA ACTCAGAAGA AAGTGGAGTG ATCATATAAC GACAATGAAG AATCTCTTTA ACTTGTTCCT TATGTTTTTC TTTGCAATGC CAATTCTTTC  ACTCTCCGAG AATCCAACCA ATTTCAGCGA GAGTTGCGAA GACGGGAGTG GAGAAACCGG TTCAAGCTTT GGCATAGGGT TCGATTTGGT TCTTGATTTT GGTTTATACC GGAATAGCTG  CCCCGAAGCA GAGTCTATCG TCTACTCGTG GGTGGAAACC ACGGTGTTAG AGGATCCAAG AATGGCTGCT TCTCTTCTCC GTCTTCATTT CCACGACTGT TTTGTCAATG GATGTGATGC  TTCGGTGTTG TTAGATGACA CAGAAGGACT GGTTGGTGAA AAAACGGCGC CTCCTAATCT AAATTCTCTA CGAGGGTTCG AAGTGATTGA TTCGATAAAG TCTGATATTG AATCTGTATG  TCCAGAGACC GTCTCATGCG CAGACATTCT TGCCATGGCT GCTAGAGATT CAGTCGTTGT GTCGGGTGGA CCAAGGTGGG AGGTGGAAGT AGGAAGAAAA GACAGTAGAA CAGCAAGCAA  ACAGGCAGCA ACAAATGGCT TACCCTCACC AAACTCAACC GTATCAACTC TCATCTCTAC TTTCCAGAAT CTTGGCCTTT CACAAACCGA CATGGTCGCT CTTTCCGGTG GACATACATT  GGGAAAGGCA CGGTGCACTT CGTTTACAGC TCGGTTGCAG CCACTGCAAA CTGGACAACC AGCTAACCAC GGAGACAACC TTGAGTTCCT CGAGTCACTG CAACAGTTAT GCTCGACTGT  TGGGCCCAGT GTAGGTATCA CTCAGCTTGA CTTGGTGACT CCATCAACAT TTGACAACCA GTACTATGTA AACCTCCTCT CGGGTGAGGG ATTGCTTCCA TCAGACCAGG CTTTAGCGGT  TCAAGACCCA GGGACAAGGG CGATTGTTGA GACCTACGCA ACAGATCAGT CGGTTTTCTT TGAGGATTTT AAGAACGCTA TGGTTAAAAT GGGAGGGATA CCCGGTGGTA GTAATAGCGA 
GATTAGGAAG AATTGTAGAA TGATTAACTA AAAATAAAAG CCCGACTTAT TGAATGATAT CTAATTATCT ATATAAAAAT TAAAGAAGTC CACCTACGTA 

Retrieve as FASTA