Entry information : AtPrx42(At4g21960 / PER42 / AtperoxP42 / PRXR1 / ATP1 / Atprxr1ge)
Entry ID 208
Creation 2006-09-18 (Filippo Passardi)
Last sequence changes 2006-09-18 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2019-01-17 (Christophe Dunand)
Peroxidase information: AtPrx42(At4g21960 / PER42 / AtperoxP42 / PRXR1 / ATP1 / Atprxr1ge)
Name AtPrx42(At4g21960 / PER42 / AtperoxP42 / PRXR1 / ATP1 / Atprxr1ge)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flower buds
Flowers
Hypocotyls
Leaves
Roots
Rosettes
Seedlings
Seeds
Siliques
Stamen Abscission Zone
Whole plant
Inducer Constitutively induced
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx42
start..stop
S start..stop
AlyPrx42 681 0 1..330 1..330
AhalPrx24 678 0 1..330 1..330
BstrPrx72 676 0 1..330 1..330
CrubPrx94 676 0 1..330 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11648085..11648312 228 N° 2 11647775..11647963 189 N° 3 11647508..11647673 166 N° 4 11646613..11647022 410
complement(join(11646613..11647022,11647508..11647673,11647775..11647963,1164808 5..11648312))


exon

Literature and cross-references AtPrx42(At4g21960 / PER42 / AtperoxP42 / PRXR1 / ATP1 / Atprxr1ge)
Literature REFERENCE 1 Cai S, Lashbrook CC. Stamen abscission zone transcriptome profiling reveals new candidates for abscission control: enhanced retention of floral organs in transgenic plants overexpressing Arabidopsis ZINC FINGER PROTEIN2. Plant Physiol. 2008 Mar;146(3):1305-21
Protein ref. UniProtKB:   Q9SB81
DNA ref. Phytozome 11:   Chr4 (11648312..11646613)
mRNA ref. GenBank:   NM_118317
Cluster/Prediction ref. Phytozome Gene 11:   19648011 UniGene:   At.23508
Omic ref. AtProteome:   At4g21960 ATTED-II:   At4g21960 e-FP Browser:   At4g21960 ePlant:   At4g21960 Genevestigator:   At4g21960 TAIR:   At4g21960
Protein sequence: AtPrx42(At4g21960 / PER42 / AtperoxP42 / PRXR1 / ATP1 / Atprxr1ge)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (307)
PWM (Da):   %s   37133.98 (34813.8)  
PI (pH):   %s   7.77 (7.81) Peptide Signal:   %s   cut: 24 range:24-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGKGVMMVAILCLWALSATSEAVTEAEPGLMMNFYKDTCPQAEDIVREQVKLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRELGEKEHDRSFGLRNFRYIEEIKEALERECPGVVSCSDILVLSAREGIEAVGGPYIPLKTGRRDGLKSRTDMLESYLPDHNESISVVLEKFKSIGIDTPGLVALLGSHSVGRTHCVKLVHRLYPEVDPSLNPDHVPHMLHKCPDSIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLLVDHQLAHDKRTRPIVKKMAKDQAYFFKEFTRAIQILSENNPLTGSKGEIRKQCNLANKNH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns), 13 cDNA and 1498 ESTs. Constitutively expressed in the whole plant, with the highest expression in roots. test
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGGAGCCAC TGAGCTAGAG AGTGACATCA CTAGAAGGTC CCCAGAGACT CATTTGGCGA CACTTGGATA AGGAAACAAA GTGTCGGTGG TCACAGTTCA TTCATTTTTA ATTGAAAAAA  TCAAATTTGT TCATTTAAAA AAAAAATTGG AAAATCCAAA TATCCAAATT TGAAGTGAAT TTGAATCTGC AGATTCAATG TGATCTTGGT AAAAGCACCG ATACTTCCCC CAGATGAAAA  AAAAAAATAA AAAAAATTCT AGGATTAAGA AAAGAAGAAG AATCGAATTA GTAGTAATGT CCTCTCATTT TATAGCTCTG TTACATATTT ATTTAGTTTT AATCATTCTA AACAAAATTA  GTCCTTTGTT ACTGAAACGA GAAACATAAT AGTTCCGCAA CAAATAATAG TGGAGCCTTT AGCTTTTAAT TAGATATCTA GTTTACCTCT ATGAAAATTA GTTAAGAATA TGAAAGATAA  CATAATTTCA GATTTTTCTT AATTTTGCAG GGACATATTA GTATACCTAT TTACCTTCTT AGTTTATGTG AAAAATATCA AAACAACGTT TATGTTAAAA CATAGGAAAA GTTCAAAATG  TACTCTAAAC TAAATTCAAT ATTTAACTTC AACCCACAAA CAGATAAAGT ATAGGGAACA CTCAAGAGTG AAGAGTGGTG AACGTGTTTT ATTACATCAC ATGGATCAAG ATTCATTCAA  TATTTGAGAA GACTTTACGA TACGAATCTA CTGACAATTA CTACAATAAG TAAAATAGTT GGATATATAA ATAACTACAG AACAAAAAGT AATTGAATAT GTACAAATGG AATTATATCT  TGAACTAAAT AATCGAAATG TACTTGAAAA AATAAGAATC CACCTTGAGT TCATCGAAAA GAAAGATTCC ATAACCTAAA AGGAGCGGTT TATCCGTTGT ATTAAAAATT TAACAATAAC  AAATGTTTCA GGTAATTGCA AATCGACCCA TGAATATATT TTGACTTTAG CTATTCCACC CCATAAATAT TATTTGTTAT AGCCGCCCCC TTTGTGTGTA TTATTAACAA AAGAAGCATA  AGTTTTTTTT GTAAGATTCT TTTTAGTCAT AGGGGCCACT GATGCCACTC AATGAGACCA AAATCCAAAA CTTAGTGATT GGTTTTTTGT TTGACAAAAA AATGTGAATT GTTTAGTTAA  CCAAAATACT CTTCTAAATG AGGTAAACTA TCTAACAAGC CATCCACATT AATATCTCCA ACCTAAACTT ATTTATTTTC TCATAGCACT GTGTAGGACT CTAACTAGCA TGATCTATGG  TCACTCACCC GTCCTTCGAA ATAGTAACAA AGTTGGGTTT TAGATTTCTT ACCGAAATTA AATTTCCAGT AGAACGTCTA GCATACATTT GAGTAATTTC AATGAAACTC CACAAATTAA  TTTTTATCAG TTTGGAAAAT ATATGTTTTG GCAACAGTCC ATATGAAAGT TCATACATTA AAAAAAAAAA ACGTAGAAAA ACTTTGTTAT TTTTTCTCAA ATTCAAACTT ACACTAATTT  AGCTGTCGCA TCAATTAAGT ATGATTTTTT TTTCTGTTTA AAGCTTATAA TGTGTCTGCA ATTTGATAAA TAATAAAAAA AATTACATAA GTTTCTTATA ATAAGTCTAC GCTTTTCAAT  TTTCATTGAA TATAGATTCT TAATCACGAC TGAACGGAAC ATACAATTAT TGTAGTCTTA TAATAATATT GTTGGTTTCT CAAAGTGAAA ATGAATAAAG CTTAATGATA TATGATCTGT  CACGTACTTA AACATATAGA AACAGTAGCA AATTCACCAA CTTGCCTTTA ATTTACTATA ACCTTCAAAT TAAGCTTCTT TTATTTTATG AAAAATAAAT AAAGAAAACT CCATTTCCCT 
TTATTTAAGG AGGCTGCATT GCTTGCTCAC TGACTCAACT CAAGAGTGGT GTAGTGAGAG AAGAAAGATA GAGAAAAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGTTGGAAAA AGTGAGAAAG ACAGGGGCTC TGGTGTGTTG AGTTCTCTGC TTGGTACGAA CCAAGATGAA TAAAAAAATC TTTTAAGTTA AATCAAAGAA AGGGTGATGA TGAATACATC  ATGGTAGTGA CCACCTCCTT CTTTTGTGTG TTCAGCCTTA ATGCTTTAAT TATGATGTTA GTGGCTTTGA GTTATTTAAT CTAAATGTTG GCTCTTCGTT GATTTTGGGT TTGTGGTGGG  GGTGATATAA TGATAATGGA AAGGATGTAT GATATGATGG ATGGTGTTGG GTATCATGTA TGACGATGTA ATGATAAGTA AACATGTCCG AATCTTTTGA TAATTTGTTC AACATGCATG  GTATACATAA GTACTGTGTA TGGGTGATAT CGATCTATTT TACTGATCTC ACCAAAGATT TTAAAAATTT GTAGTAAATG ACATGAATAA TTGAATATGA TATGACTCAT GAAAAAGATT  CCAAAAATAA TAATTCAAAA TAAGAGAAAC GGGCCACAAG CTAAAGAGTA AAGCCAAAAG TCGCAAGCAA AAAGAAACAA AGGCGTAGTA ATATTTAATC ACATGACCCG CATTGAATTG  TAAAGGACAG AGACATGTTA TATATAGAGA AAAAAAATAT CTAACGGATG AGATTCTCTT CGAGGGTATA TAGACTATAG TCTGTACTTA AACACTTCAA TTAGAAAATA CATAGAAAAC  GTTAGGTAGA CTTTAACTTT TCTTAAAACT AGACGTGAGA GACAATAATG GTGGTGGCGT GTAGACAACA AATGCAGTGA TCTATGGTTT AAGATATTTG CAGTTTCAAA TCCGAAAATT  TATTTAAACA TCCACAGATA CACTTGGAGC AGCATTAACG TATTATGTAG AGTGTCAGCG AGTTTCATTT GTTTTCTACA AAATAATTGG GATAGAAAAT TATAAGTTGC ATCAACTTGT 
TAGCTTCTGT ATTTATTCAT TTTGTCGACA TTTGTTAGCT T 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGCAAAGGTGTGATGATGGTGGCGATACTTTGCCTTTGGGCACTCTCTGCAACATCTGAAGCAGTAACAGAGGCTGAGCCAGGTTTGATGATGAACTTCTACAAGGACACGTGT
CCTCAGGCCGAAGACATCGTCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTCTCTTGGCTCCGTAACATCTTCCATGACTGCGCCGTTGAG
GTCCGAAAACTC
TCTCTCTTACAATGATCTTTCATATGTTTGCATGATGGGTTTTGATATTTTACCTAAAACAGATCTAAAGATTTTACTCTGTTTTGCTCTGTTTTTTTGGGTTAAACAGTCATGTGATGC
GTCGCTTTTGCTGGATTCGACAAGAAGAGAGCTAGGAGAGAAAGAACACGACAGGAGCTTCGGACTTAGAAACTTTAGGTACATCGAGGAGATCAAGGAAGCTCTCGAGAGGGAGTGTCC
TGGTGTTGTCTCATGTTCTGACATTCTCGTCTTGTCCGCAAGAGAAGGCATCGAAGCA
GTAAGTTTAAAGGATAATAATCGTGCCGTTTTCTCTGTCTGGTGACAAAACTGCATGCTGTT
TTTTTCCTTTTTTGACAAAACTGTGTGGGGTTGGTGTAGGTAGGAGGACCTTATATTCCTTTGAAGACAGGAAGGAGAGATGGACTTAAAAGCAGGACGGATATGCTCGAGTCATATCTT
CCCGACCACAACGAGAGTATCTCCGTCGTTCTTGAAAAGTTCAAATCCATCGGTATCGACACTCCCGGCCTCGTCGCCCTCCTAG
GTACCTTTTATCTTTCTCATCCTTGATTATTTGTC
ACTAGGCTCCGGAAAAAACGTAACGCTTGAAATTAAAAACTCTTGACCAACCGAGATATTTTGTTGCTGCTGCCTTAGATTAAGGGTATTTCAGTCAATTTACTCATGCATGAAACACTC
TTATGACTAATGAACCACTACTAAAGCTAACTTTATTGAATCACAAAAGGAGTGTATGCGATCTGAGTTGAACTTTGAAAGTTATCCTTATCCGATCTATCACTAGTACTAACAAATAAG
ACAGGATAATCCTTGTTTATGCCCCGGTACAATAGCCTAGCACAAGGTTATTTTGGTCAATAAACTCATGCATGCTTAAACATACTAATCAAACTAATTGACTTTACTCTTATGGGATCT
GAATTTAGGCGATTGGAATTTAAGTTTCTTGTTAGATTTTTAAGTTCGATACTGAAAGATTTTGACTTTTTTTTTTTATGACACGTGCAGGGTCACACAGCGTGGGAAGAACTCACTGTG
TCAAGCTGGTCCATCGTTTGTACCCTGAGGTGGACCCGTCCTTAAACCCGGACCACGTCCCTCACATGCTACACAAGTGTCCTGACTCGATCCCTGACCCAAAGGCGGTCCAGTACGTGC
GTAACGACCGTGGCACCCCCATGGTGCTAGACAACAATTACTACCGTAACATCCTAGACAACAAGGGTTTGCTCCTTGTGGACCATCAGCTCGCACACGACAAACGAACCAGACCAATCG
TTAAGAAGATGGCTAAGGACCAGGCCTACTTCTTCAAGGAGTTCACTAGGGCAATCCAGATCTTATCCGAGAACAACCCCTTGACTGGCTCTAAGGGTGAGATCAGGAAGCAATGTAATC
TCGCAAACAAGAACCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGCAAAGGTGTGATGATGGTGGCGATACTTTGCCTTTGGGCACTCTCTGCAACATCTGAAGCAGTAACAGAGGCTGAGCCAGGTTTGATGATGAACTTCTACAAGGACACGTGT
CCTCAGGCCGAAGACATCGTCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTCTCTTGGCTCCGTAACATCTTCCATGACTGCGCCGTTGAG
TCATGTGATGCG
TCGCTTTTGCTGGATTCGACAAGAAGAGAGCTAGGAGAGAAAGAACACGACAGGAGCTTCGGACTTAGAAACTTTAGGTACATCGAGGAGATCAAGGAAGCTCTCGAGAGGGAGTGTCCT
GGTGTTGTCTCATGTTCTGACATTCTCGTCTTGTCCGCAAGAGAAGGCATCGAAGCA
GTAGGAGGACCTTATATTCCTTTGAAGACAGGAAGGAGAGATGGACTTAAAAGCAGGACGGAT
ATGCTCGAGTCATATCTTCCCGACCACAACGAGAGTATCTCCGTCGTTCTTGAAAAGTTCAAATCCATCGGTATCGACACTCCCGGCCTCGTCGCCCTCCTAG
GGTCACACAGCGTGGGA
AGAACTCACTGTGTCAAGCTGGTCCATCGTTTGTACCCTGAGGTGGACCCGTCCTTAAACCCGGACCACGTCCCTCACATGCTACACAAGTGTCCTGACTCGATCCCTGACCCAAAGGCG
GTCCAGTACGTGCGTAACGACCGTGGCACCCCCATGGTGCTAGACAACAATTACTACCGTAACATCCTAGACAACAAGGGTTTGCTCCTTGTGGACCATCAGCTCGCACACGACAAACGA
ACCAGACCAATCGTTAAGAAGATGGCTAAGGACCAGGCCTACTTCTTCAAGGAGTTCACTAGGGCAATCCAGATCTTATCCGAGAACAACCCCTTGACTGGCTCTAAGGGTGAGATCAGG
AAGCAATGTAATCTCGCAAACAAGAACCATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTACTATA ACCTTCAAAT TAAGCTTCTT TTATTTTATG AAAAATAAAT AAAGAAAACT CCATTTCCCT TTATTTAAGG AGGCTGCATT GCTTGCTCAC TGACTCAACT CAAGAGTGGT  GTAGTGAGAG AAGAAAGATA GAGAAAAAAA ATGGGAGGCA AAGGTGTGAT GATGGTGGCG ATACTTTGCC TTTGGGCACT CTCTGCAACA TCTGAAGCAG TAACAGAGGC TGAGCCAGGT  TTGATGATGA ACTTCTACAA GGACACGTGT CCTCAGGCCG AAGACATCGT CCGTGAACAA GTCAAACTCC TCTACAAACG CCACAAGAAC ACCGCTTTCT CTTGGCTCCG TAACATCTTC  CATGACTGCG CCGTTGAGTC ATGTGATGCG TCGCTTTTGC TGGATTCGAC AAGAAGAGAG CTAGGAGAGA AAGAACACGA CAGGAGCTTC GGACTTAGAA ACTTTAGGTA CATCGAGGAG  ATCAAGGAAG CTCTCGAGAG GGAGTGTCCT GGTGTTGTCT CATGTTCTGA CATTCTCGTC TTGTCCGCAA GAGAAGGCAT CGAAGCAGTA GGAGGACCTT ATATTCCTTT GAAGACAGGA  AGGAGAGATG GACTTAAAAG CAGGACGGAT ATGCTCGAGT CATATCTTCC CGACCACAAC GAGAGTATCT CCGTCGTTCT TGAAAAGTTC AAATCCATCG GTATCGACAC TCCCGGCCTC  GTCGCCCTCC TAGGGTCACA CAGCGTGGGA AGAACTCACT GTGTCAAGCT GGTCCATCGT TTGTACCCTG AGGTGGACCC GTCCTTAAAC CCGGACCACG TCCCTCACAT GCTACACAAG  TGTCCTGACT CGATCCCTGA CCCAAAGGCG GTCCAGTACG TGCGTAACGA CCGTGGCACC CCCATGGTGC TAGACAACAA TTACTACCGT AACATCCTAG ACAACAAGGG TTTGCTCCTT  GTGGACCATC AGCTCGCACA CGACAAACGA ACCAGACCAA TCGTTAAGAA GATGGCTAAG GACCAGGCCT ACTTCTTCAA GGAGTTCACT AGGGCAATCC AGATCTTATC CGAGAACAAC  CCCTTGACTG GCTCTAAGGG TGAGATCAGG AAGCAATGTA ATCTCGCAAA CAAGAACCAT TGAAGTTGGA AAAAGTGAGA AAGACAGGGG CTCTGGTGTG TTGAGTTCTC TGCTTGGTAC  GAACCAAGAT GAATAAAAAA ATCTTTTAAG TTAAATCAAA GAAAGGGTGA TGATGAATAC ATCATGGTAG TGACCACCTC CTTCTTTTGT GTGTTCAGCC TTAATGCTTT AATTATGATG  TTAGTGGCTT TGAGTTATTT AATCTAAATG TTGGCTCTTC GTTGATTTTG GGTTTGTGGT GGGGGTGATA TAATGATAAT GGAAAGGATG TATGATATGA TGGATGGTGT TGGGTATCAT  GTATGACGAT GTAATGATAA GTAAACATGT CCGAATCTTT TGATAATTTG TTCAACATGC ATGGTATACA TAAGTACTGT GTATGGGTGA TATCGATCTA TTTTACTGAT CTCACCAAAG 
ATTTTAAAAA TTTGTAGTAA AT 

Retrieve as FASTA