Entry information : AtPrx47 (At4g33420 / PER47 / AtperoxP47 / ATP32)
Entry ID 213
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: AtPrx47 (At4g33420 / PER47 / AtperoxP47 / ATP32)
Name (synonym) AtPrx47 (At4g33420 / PER47 / AtperoxP47 / ATP32)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Mixed tissues
Seedling shoots
Vascular tissue
Xylem
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx47
start..stop
S start..stop
AlyPrx47 667 0 1..325 1..325
CrubPrx54 650 0 1..325 1..325
CagraPrx66 647 0 1..325 1..325
BstrPrx62 640 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16084856..16085101 246 N° 2 16085188..16085376 189 N° 3 16085474..16085636 163 N° 4 16085726..16086105 380
join(16084856..16085101,16085188..16085376,16085474..16085636,16085726..16086105 )


exon

Literature and cross-references AtPrx47 (At4g33420 / PER47 / AtperoxP47 / ATP32)
Literature Tokunaga N, Kaneta T, Sato S, Sato Y. Analysis of expression profiles of three peroxidase genes associated with lignification in Arabidopsis thaliana. Physiol Plant. 2009 Jun;136(2):237-49.
Protein ref. UniProtKB:   Q9SZB9
DNA ref. Phytozome 12:   Chr4 (16084856..16086105)
mRNA ref. GenBank:   NM_119496
Cluster/Prediction ref. Phytozome Gene 12:   19645536 UniGene:   At.28650
Omic ref. AtProteome:   At4g33420 ATTED-II:   At4g33420 e-FP Browser:   At4g33420 ePlant:   At4g33420 Genevestigator:   At4g33420 TAIR:   At4g33420
Protein sequence: AtPrx47 (At4g33420 / PER47 / AtperoxP47 / ATP32)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   35837.77 Transmb domain:   %s   i12-34o
PI (pH):   %s   8.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLTRFKKQNNKMVRANIVSMVLLMHAIVGFPFHARGLSMTYYMMSCPFAEQIVKNSVNNALQADPTLAAGLIRMLFHDCFIEGCDASILLDSTKDNTAEKDSPANLSLRGYEIIDDAKEKIENRCPGVVSCADIVAMAARDAVFWAGGPYYDIPKGRFDGKRSKIEDTRNLPSPFLNASQLIQTFGQRGFTPQDVVALSGAHTLGVARCSSFKARLTVPDSSLDSTFANTLSKTCSAGDNAEQPFDATRNDFDNAYFNALQMKSGVLFSDQTLFNTPRTRNLVNGYALNQAKFFFDFQQAMRKMSNLDVKLGSQGEVRQNCRSIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns), 6 cDNA and 4 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCACAACCG ATATCAACAC TTGATTCAAC TGAAATTTTG TTGATAGAAT CTTTGTAGTC TCAATCCAAT GATTTTAAGA GCTTGATCAG TGTGAAGTAT AGTGAGATTA TGATGTATAA  TCTGTTTTCG ATGTGGATAT ATAGGTACCA TCTACGTTAG GACCGGTGAT CTTCATGTCA TGGCGGAGAA AGGATCTTGC GGAGCTGTGG GAAGGACCTG CATTATCTAA TCCCATTGAG  AAATCTCATG AAATAGAGAT CTGAGTTTAT TATATCAATC AAGATGATTC AGAAATCTAA AACATATTAC ATAAAACAAA GACGCTTAGT AGGAAAACAT CAGATCAAGA ATTCTTGTAT  TCTTAAGTTC CCAAAAAAAG AAAAAAAAAA AAAAAATTGG TCAGAAAGAG AGATGATGTC TTATATCCCT CATTTTTTTT GCGTTACTCA AAGGGAGGAA AAATAAACAA TTAACAAGTT  CTTTAATTTT TTCTTATGAA TAGAGATACC AATACTAAAA AACGTTGGCT TTTGTAATGA AGAAGTTTTA GTGATAATAT AAGTTAAAAT TAAAAGTGTG TAACCAATTA GTCTTTTTTT  TTTCCGTCAA AAAAAAGAAA AAAAAAAAAA AGACTAATTG GTTACACACT TTTAATTTTA ACATATATTA TCACTAAAAC CAATTAGTCA ATTACACAAA TTTAGTAATA ATACATAGGG  TCTCTAATAT ATATTAAGCT TTATATAAAC TAATGAGGAA ATCTGTAAAA ATATACAAAT AAGAATTTCC AAAGTAGATC CTATGTAATT TCGAAGCGTA TTACTGTGCA TAAGACAGTG  TTAACCAAAA AAAAAAAAAA ACATTTCCGA GATGAACTGT GTTTTGTCCT CACCGGATAA GAAAGTGGAA GAATGAACCA CTACAAAGTC CGCGTCGAAA GCACTCAGTT ATAAAAGTAA  AATTGACATG CGATTACATT AAAAATACCA AACTCGCTTG TCCATTTTTA TTGATATTGC TTGCTAATGG AAGCCAGCTA CATGTCCGCT TTCTTGTTTG ACTTTCTTTC TTTTCTCTTT  GAGTTCTCTT CAATATTAAT AGATGCATTT TATGTTTTGC TTCTTCTGAG TAGCATCGTG AATCAAGTCG CCATTATCTT ATTCAGCACT AATATAATTA TATATAGCCA GAATTTCTAA  ATTTCAAGAA TGTAGACAAG TTCTAGAAAC GCCGTCCACA GTTCCATAAA TTCTAGCTAG TTTTCTGTAA TATTTCACAT AACGATTCAT AGACTTTTCT GTTCAGACAA ATATATACTT  TGCAAAACAG AACATCAAGC TCAGTAGCTC ACAACCAAAA TTCTCTGTCC AAATTTGAAG TAACGGAACC TAGTGTCTTG CTGGGTTTGA GACTTCTCAA TCACCATATA GTCAGAAATA  CCTATGAATA AGATTATCTT GATGATTTTT TAAAAAAAGA TTTTCTTCGT TAAGCTTTTC TTTTGTAATT AGTTATAAAC CTTCTCACTT TCAATGAAAT TCACATTCAT ATAAGTTTAA  ATTTTAAATT AAAATATTGG TCAGCTATAG ACTATAGTAA GTATATTAAA TAATAATAAC ATTTTTTGTG GACAAAGAGA ATTCGGGTTT TGGGGTTTTG GCAAAGGAAA GAAATGGTCA  TATGTGGAAC ACTACGTGCC ACTTTTCATG CAATAACATG CAAATATTAG GTCAGCCACT AGGAATAGAA TAAGTTGAAT AGTTTTTTAC GATGATAAGA GTAAGCGGGA AGCCATAATA  GACCACTATC CCAAAACTTT AATCTGCTTC CAACTCATTA TGGGACCAAC TAATACAAAA TGATATGTAT TCCATGTTCC AACCACTCCA ATACGAATTA CGAAGCAAGC GTGTCTCAGT 
GTCTGAGTGC GACTGCCTTC TCTCTATATA TAAGAGATAT ACATAGTGAA TTAAACATCT TAATTATACT GATCTTTATC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCTAGACCAC ATCTACTTAC GATTTTTGTA TTTATAATAA GTTCTCTACT CTTGTTATAT GAAGAATCAT GAATCTTCTA GGCTACTATG TAAAAATTGT GTACTCTCGT AATATGCAGT  TGTATACTTA TTGCTTGTGT GGTTCAGATA TCCATCAAAA AGTAATATAC TTTGGTTGCA TTTTCTTGTC CAATTGCTAT TTAAAGGCAA AAGTCTCCTT TTCTTCTGAA CAATCTCCGG  ATCTAGAAAT CACATGATAA CACAGAAACC GGTAAGAAAA GAAACCTGAC GCACGGTGAA AAAGAATAAT TGATGGGATA CATATTTGTG AATCAAGTGC GCAACAATCC TCAAGTGGTG  AGCTTAAGAC ATGTTTGGGT TTTAGCTTTC AACAACATTC AAATCCTTTT TCATCATATA ACACTTACAA ACCCAATCTG ATCCTCATGT ATTCACTTAA GAACCAATAA TATGGAGCAG  CAGAAGCTAA AACCCTCAAT AAATACAGAG AAAAACAAAA TACAGAAAAA ACATTCGTGT TTCGAATCTT ATCTTGGACC CGAGGGGTAT TCGTTTTCGA TCTGGGAAGT GGAATCGCCA  ATGATCCAGC CAGACACGGC TGGATGGTGG GTTGGGTAGT TGAAATCTTG TCTGAACATT TCCTCCTTTT GCCACTCTTC CCATCTCTCA GCTAAACCAT CTCCTTCAAG CATTCTTACA  ACTTCAGACA TTTTGGGTCT TTCCATTGGT GAACTCTGAG TGCAGAGTAA AGCCACTTGG ATTAGCTGCT CCACTTCTTC GTCTTTGTAA TTACCCTGAA GATCAACATC TACTAGTGCT  TCCAATTTCT TCTCTTTTAA CAACCCTTTC ACCTGTCGAA ATGAATAATT AACACAAATA GAGGTAACAC AGATAATGAA CTATACAAGT GGGAAACTCA TATATGTATA TACCCAGTCT 
AGTAACATGA CATCATCATC ATTCGCGAGG CGAGCAAGAT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGACTAGATTTAAGAAACAAAATAATAAGATGGTTAGGGCAAATATAGTGAGCATGGTTCTGTTGATGCATGCCATCGTTGGGTTTCCTTTTCATGCGAGGGGATTAAGTATGACT
TACTACATGATGAGCTGTCCTTTCGCTGAACAGATTGTGAAGAACAGTGTTAACAATGCTCTTCAAGCCGATCCCACTTTAGCCGCTGGTCTTATCCGTATGTTGTTCCACGACTGTTTC
ATCGAG
GTACTTAACGTTTTCTGTTTAATTAATTGTGTTTTTTTCGTAGAAAAACCCTTAAAATTAATGTGTAATTTTTGGTTCATAATAAGGGATGTGATGCGTCAATTCTGCTAGATT
CAACGAAAGACAACACTGCGGAAAAGGATTCGCCTGCGAATCTGAGTCTACGTGGCTACGAGATCATCGATGATGCAAAGGAGAAAATCGAGAATAGATGTCCAGGAGTTGTATCATGCG
CAGATATAGTTGCCATGGCTGCTAGAGATGCTGTCTTTTGG
GTAATTTATTTGATCACGTTTTTGAATTACCTTTATGTGATTATAGTAAATATGATTAATTAGTGTACTTAACATAATT
AGTAATTGAAATTGTTAGGCTGGTGGTCCATATTATGACATACCGAAAGGAAGGTTTGATGGTAAAAGATCAAAGATAGAAGATACAAGAAATCTACCTTCACCTTTTCTTAATGCCTCT
CAACTCATTCAAACTTTTGGCCAACGTGGTTTCACTCCACAAGATGTTGTTGCTCTCTCTG
GTCAGTTCTTTAAAGAACTAATATATGTGTATTGTGTGTGATAATCTAATTTGGTTTTA
ACTTAATAATTTGTGGGGATATATATATAGGAGCACATACCCTAGGAGTTGCACGATGCTCCTCCTTCAAGGCTAGACTTACCGTCCCAGACTCTTCATTAGACTCGACTTTTGCAAACA
CTCTCTCTAAAACATGCAGCGCGGGTGACAATGCAGAGCAACCCTTTGATGCTACGCGCAACGATTTCGACAATGCTTACTTCAATGCGCTTCAGATGAAATCAGGAGTCCTCTTTTCAG
ACCAAACTTTATTCAACACACCAAGGACCAGGAATCTTGTTAACGGCTATGCACTTAACCAAGCCAAGTTCTTCTTTGATTTCCAACAGGCCATGCGCAAGATGAGCAATCTTGATGTTA
AACTTGGCTCTCAAGGTGAAGTCCGTCAAAATTGTCGGAGTATTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGACTAGATTTAAGAAACAAAATAATAAGATGGTTAGGGCAAATATAGTGAGCATGGTTCTGTTGATGCATGCCATCGTTGGGTTTCCTTTTCATGCGAGGGGATTAAGTATGACT
TACTACATGATGAGCTGTCCTTTCGCTGAACAGATTGTGAAGAACAGTGTTAACAATGCTCTTCAAGCCGATCCCACTTTAGCCGCTGGTCTTATCCGTATGTTGTTCCACGACTGTTTC
ATCGAG
GGATGTGATGCGTCAATTCTGCTAGATTCAACGAAAGACAACACTGCGGAAAAGGATTCGCCTGCGAATCTGAGTCTACGTGGCTACGAGATCATCGATGATGCAAAGGAGAAA
ATCGAGAATAGATGTCCAGGAGTTGTATCATGCGCAGATATAGTTGCCATGGCTGCTAGAGATGCTGTCTTTTGG
GCTGGTGGTCCATATTATGACATACCGAAAGGAAGGTTTGATGGT
AAAAGATCAAAGATAGAAGATACAAGAAATCTACCTTCACCTTTTCTTAATGCCTCTCAACTCATTCAAACTTTTGGCCAACGTGGTTTCACTCCACAAGATGTTGTTGCTCTCTCTG
GA
GCACATACCCTAGGAGTTGCACGATGCTCCTCCTTCAAGGCTAGACTTACCGTCCCAGACTCTTCATTAGACTCGACTTTTGCAAACACTCTCTCTAAAACATGCAGCGCGGGTGACAAT
GCAGAGCAACCCTTTGATGCTACGCGCAACGATTTCGACAATGCTTACTTCAATGCGCTTCAGATGAAATCAGGAGTCCTCTTTTCAGACCAAACTTTATTCAACACACCAAGGACCAGG
AATCTTGTTAACGGCTATGCACTTAACCAAGCCAAGTTCTTCTTTGATTTCCAACAGGCCATGCGCAAGATGAGCAATCTTGATGTTAAACTTGGCTCTCAAGGTGAAGTCCGTCAAAAT
TGTCGGAGTATTAATTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAACATCTTA ATTATACTGA TCTTTATCAT GTTGACTAGA TTTAAGAAAC AAAATAATAA GATGGTTAGG GCAAATATAG TGAGCATGGT TCTGTTGATG CATGCCATCG TTGGGTTTCC  TTTTCATGCG AGGGGATTAA GTATGACTTA CTACATGATG AGCTGTCCTT TCGCTGAACA GATTGTGAAG AACAGTGTTA ACAATGCTCT TCAAGCCGAT CCCACTTTAG CCGCTGGTCT  TATCCGTATG TTGTTCCACG ACTGTTTCAT CGAGGGATGT GATGCGTCAA TTCTGCTAGA TTCAACGAAA GACAACACTG CGGAAAAGGA TTCGCCTGCG AATCTGAGTC TACGTGGCTA  CGAGATCATC GATGATGCAA AGGAGAAAAT CGAGAATAGA TGTCCAGGAG TTGTATCATG CGCAGATATA GTTGCCATGG CTGCTAGAGA TGCTGTCTTT TGGGCTGGTG GTCCATATTA  TGACATACCG AAAGGAAGGT TTGATGGTAA AAGATCAAAG ATAGAAGATA CAAGAAATCT ACCTTCACCT TTTCTTAATG CCTCTCAACT CATTCAAACT TTTGGCCAAC GTGGTTTCAC  TCCACAAGAT GTTGTTGCTC TCTCTGGAGC ACATACCCTA GGAGTTGCAC GATGCTCCTC CTTCAAGGCT AGACTTACCG TCCCAGACTC TTCATTAGAC TCGACTTTTG CAAACACTCT  CTCTAAAACA TGCAGCGCGG GTGACAATGC AGAGCAACCC TTTGATGCTA CGCGCAACGA TTTCGACAAT GCTTACTTCA ATGCGCTTCA GATGAAATCA GGAGTCCTCT TTTCAGACCA  AACTTTATTC AACACACCAA GGACCAGGAA TCTTGTTAAC GGCTATGCAC TTAACCAAGC CAAGTTCTTC TTTGATTTCC AACAGGCCAT GCGCAAGATG AGCAATCTTG ATGTTAAACT  TGGCTCTCAA GGTGAAGTCC GTCAAAATTG TCGGAGTATT AATTAGGCTA GACCACATCT ACTTACGATT TTTGTATTTA TAATAAGTTC TCTACTCTTG TTATATGAAG AATCATGAAT 
CTTCTAGGCT ACTATGTAAA AATTGTGTAC TCTCGTAATA TGCAGTTGTA TACTTATTGC TTGTGTGGTT CAGATATCCA TCAAAAAGTA ATATACTTTG GTTGCATTTT CTTGTCC 

Retrieve as FASTA