Entry information : AtPrx48 (At4g33870 / PER48 / AtperoxP48)
Entry ID 214
Creation 2010-03-04 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Harold Duruflé
Last annotation changes 2016-06-29 (Harold Duruflé)
Peroxidase information: AtPrx48 (At4g33870 / PER48 / AtperoxP48)
Name (synonym) AtPrx48 (At4g33870 / PER48 / AtperoxP48)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx48
start..stop
S start..stop
AhalPrx36 742 0 1..404 1..405
AlyPrx48 740 0 1..404 1..405
CrubPrx86 627 0 1..404 1..414
BstrPrx32 613 0 1..392 3..390
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16236154..16236492 339 N° 2 16235573..16235761 189 N° 3 16235322..16235487 166 N° 4 16234670..16235190 521
complement(join(16234670..16235190,16235322..16235487,16235573..16235761,1623615 4..16236492))


exon

Literature and cross-references AtPrx48 (At4g33870 / PER48 / AtperoxP48)
Protein ref. UniProtKB:   O81755
DNA ref. Phytozome 12:   Chr4 (16236492..16234670)
mRNA ref. GenBank:   NM_119545 [Incorrect splicing]
Cluster/Prediction ref. Genebank:   824263 Phytozome Gene 12:   19644608
Omic ref. AtProteome:   At4g33870 ATTED-II:   At4g33870 e-FP Browser:   At4g33870 ePlant:   At4g33870 Genevestigator:   At4g33870 TAIR:   At4g33870
Protein sequence: AtPrx48 (At4g33870 / PER48 / AtperoxP48)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404
PWM (Da):   %s   44648.94 Transmb domain:   %s   i7-29o
PI (pH):   %s   4.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFLGDYKFALLTCSVIALSIYFAINVEFRFAYDSPGTRTGVKVSEKSPFDDEFMYMSIAEDIDRSYLHYDYYRESCPTAEKIIAKAIRDIYNVTPSVAPPIIRLLFHDCFIEGCDASVLLDADEAHTSEKDASPNLSLKGFDVIDAVKSELENVCPGVVSCADLLVLAAREAVLVAGGPFYPLETGRKDSAAAYRDFAEHELPAPDATLSVILQRFSFRGFNERETVSLFGAHSIGITHCTFFKNRLYNFSATGKPDPELNPGFLQELKTKCPFSVSTSSPSAPPDIGLPPSLPASDSENSYGMSSGNRNDEVIDLSYNNEGGDENFGTRYFRRLMQNKGLMSSDQQLMGSEVTEMWVRAYASDPLLFRREFAMSMMKLSSYNVLTGPLGQVRTSCSKALPRN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chrom 4, 3 introns). no EST
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCCCCACTAA AATATTATCG CAATCAATCA TATTCATGGC AATCAATATC AGATATTTGA TTTTTTATTT CTGCTTAATT GATGGATTTA TGACAAATTA AAACTACTGT TGCGAAGAAA  AAAATTACAA CTACTGTTCT ACAACTTTAT CTATATTTTG AACGGCCAAT TTTAATAGCA ATTATGAAAC CCTTATAGCA TTGAAATCTA ATGAATATCT AATTTTATAG TATTTCAGTC  TTAGAATTTA TTGAAAAACC CATCAAAAAC AACAAATAAA ACGAAAAAAA CTGTACTACT TCTAAATGTG TCTCATAGAG AGGGTGATAA AAGTTGCATT GCTTAGTGCC TAATCGATCG  ATCAAATAGT ACATGTAATC AGTACAAAAC ATATATAGAA TTAAGTACCA TTCTTTTTGC CTACCATAGT ATATAGTAAC CAAAAACTAT GGACAATACT TTCAACTTGA AAGTTTCAAG  TTTCAACGAG TGTTTTTTTT AGATAATTTA TTTTAAATGT TAATTTTTCT ATTGTACTAT CATATCTTAC CATTTTTTTT GTCCTTTCTA GTTGTATCAC TATCTATTTT ATGATCTTAA  TTTGTTTTGT AACACCATTA TTTTTTATAT TACTAGAAAT TTTTAATGAA TTTAAAATAA AAGTTCAGCT ATATTATAAT AGGTAGTCTA GTTCAAGGAC ATAGATTGAT AGATAAAAAA  AATGCTTAAT GCAAAATTGT ATATAAAAAT ATTGTAAAAT TGCCGTGATA GTTTTCAAAG TAGAATTTGA CTTTGGCTTC TGGTCACTTC TTAAATTACG GGTTGACTTA CGTTCATGGA  ATTATTATTT TTATTTTGTC AACCGGTTCA TGAATATATT TGTATGGTTG AAGTTTTTTT TTTTGATGTT AACAGCTACA GAAAATGTTA ATTATTGAAT AACTTGAATT TGTTTTACAA  TTAATATAAC ATTACAAATT AGGAACAAGT CATATAATTT TTCTCATATA CTACAGTTTT ATTATATAAG AAAATTAAAA TAAACAATTT TTAAAGATAT TTAACAAGAC AATACTTAAA  GATTAGTTCA TTATAATACT TTAAAGAGTT TTTAGAATTT CGTAGTCTGT TTGCGCCAAA GCCCATAAAC GGCGACTGTT TCTCCCTTTG TACCTTTCTC ATATTGTTTC TCTTTATATA  ATTAAAACTT TGGAATAAAT ACGCTCAAGT ATAAGTTTTC ACTAAAATAT ACTCAATTCG ATATAATTTA TAATTACAAG AATCAATCAA CATTATTTAT CGAAATGACA GCTAATAAAA  AAACCTTCCA ATTTTTTTTA TTTTTTATTG TCAAAACCTT CCAAATTCAT AAGAAACAAA TTATATATAC ACTACTTTTT CTTAATACTT TTTTTCTTTT AGTTGTGTGT TTAAAACTTT  TATTGGACCA ACCAACTAGT TCACAGTATA CTCCAATCGT GATGTAGGAG ACAAGTACAC CAAAGATTAA CATCATCAAT ACAAAGTTAC AAACTATATG TGATCACCTT CATGACTATA  ATGCTTTAAC CAATTTTCTC TTTTGATTTC TAGAATCTAG ACCCTTCATC GTTTGGTTCA ATTGTTGAAT CATAAGCTCG TGAAATTCTA GAAATGTTTT GACTGATCCT ATAGACTAAA  GGTGAAAGTG ATTGTACTTA AACAAAAAAA TTAAAAAAAA AACCTCTAAT ATTAACTAGT ACTTTTTTTT GTTGCTTTGT TATTAAAAAA ATATAACTCT TTATTTGGGA AAAAAATATC  TGTAACCAAA AAAATATACG AAACAACTTA ACCGTCTGTA ACAAATTGCC GAACCGACTA ATTGAGGAGC AAGGGCAAAT TGGTAATTTC GTTTAGATTT CCCGCTTCTT TCATCATCTC 
CAATTTCTCA CTTCTCGAGT GTTAACAAAT TACAATCCCA GACGAACTAG ATCAGAAGAA GGAGAGAAGA AGAGAAGAGG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTCTCTTTT ACCACTTTAG CGGACTCCTG TTGATAAGAT TTGATTTTGT TTTCGAATAT ATGTAGTAAC TGAATTGAGG ATTTTGAGTT TGATTTCAGA AGGCTGATAA ATAAGTTGAG  AGTTCAATCC CTCATTGTGT ATGATAACCA TCACCAATTT TTCTACTACA TTTTTTGGCT CTGACCTCAT TTATCAAATT TTGATAGGAA AATGTCACTT TGGTTTGTGC CAAAAAAGGG  CAGGCTCTGT TATATTATTG ACGGCAGAAA ATGGTAGGCA TGCTTAAACG TATGAGTTAG TGTTAAATTA GGTAGAAAAA TGACAAGCTT GGTATATAAC GTTCAATAAT ATAAGGAAGA  TGTGGCAGAG TTAGTGTTGA GAATGGGCTA GTCTACTTGT GTTTAGGCCC ATATATATAA GGCCCATATA TATTTGAAGA CCACAAATAA CTAGGGTTTA CAAATTTGGT TATATAGCTC  TCTCTCTCGA GCCGCACATA TTTCGTCTTC TTGATCTAAT CGCTTTGAGC TGTTAGCAGA GAGCAGTCGA CAATCATGGG TCACTCCAAC GTCTGGAATT CTCATCCTAA GAAATACGGT  CCTGGTTCTC GCTTATGGTA CTATCTTTTT CTCATCTCTC GGCTTTCTTT TCTTTTAAAA TAAAAATTCT GTTTAGTTTA GAGAAATTGG GATTGCCTAA GAACTTTTAT CATGTTTATC  ATTCGAAAGA TTTTCAACAT AGGAAGATTT TTTATCTGAA CCTGATCCTT ATTGATTATG TGAAACTTTT GATGTGAAAT TTTGCTTAGG GATAGTTAAG TGTGGTGGTT TAGGTGTGTA  AAGCAGAACA CTTTATCCAT GAAGATCTTG TATTAATCTT AATAGTTTCC ATGGGATAGA AAATTGATAT GTTCCTCCGC TCTGTTTGAG TTGACTTGTT AGATTTCTTC ATTCCATTTT 
TTACTTTAGT TTACGTTAAA ACATTGTTTT GTGAATAAAT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTCCTCGGAGACTACAAGTTCGCTTTACTTACTTGCTCCGTTATCGCTCTCAGCATCTACTTCGCGATTAACGTCGAATTTCGTTTCGCGTACGATTCACCGGGAACTCGTACC
GGAGTTAAGGTTTCCGAGAAATCTCCCTTCGACGACGAATTCATGTACATGTCAATCGCTGAAGATATCGATCGATCTTACCTCCACTACGATTACTACCGTGAATCTTGCCCTACCGCC
GAGAAAATCATCGCGAAAGCTATCAGAGATATCTACAATGTCACACCCAGCGTAGCTCCGCCTATTATCCGTCTCCTCTTTCACGATTGCTTCATCGAG
GTCAGATTTTCTGATTTCTGG
CTTTCCCTTTCTTGTAATTTTGATTTCGCTAAGCTAGATCTATGGAAGATTGTTTGGGATCTTGTTTCGGGAATGTTTGATTGTGATGTCTCTGTATCGGATTTGAATTCATCTCTGTTA
GTGTAATTATGCTTGGTCAGTAGATTTTTAAGTGTGAATCTCTCAATCTTGGCTACGGATATGCAGAACTCATGTGTTTGATACTCAGATTTGATGTTATTAGCATACTTTGTGAATCAA
ATACGGATATGCACAAGTTATTTGTTTGATCCTCAGATTTGCTCAGTTTTTAATATCAAATTCTATGTTTTCTTTAGCACTTCTTGTAGTTTGCTCATGATGCTATTTGGGGAACTGTGT
TTTTGCTGCAGGGATGTGATGCATCAGTCCTTCTAGACGCAGATGAAGCACATACTTCTGAGAAAGATGCATCTCCAAACCTATCCTTGAAAGGGTTTGATGTGATTGACGCCGTTAAGT
CTGAGCTAGAGAATGTCTGTCCCGGAGTTGTTTCCTGTGCTGACCTACTTGTATTGGCAGCTAGAGAAGCCGTCCTAGTT
GTAAATTTCCCCTCTCTCACTCTCTCTTCTGGTTTGTGCA
TGTTAATAGTGCTGCAACGCTTGATCATGTCTTTGAAACTATCAGGCTGGTGGTCCATTCTATCCCCTAGAAACTGGAAGGAAGGATAGTGCAGCAGCCTACAGGGATTTTGCAGAACAC
GAGCTTCCTGCACCAGACGCTACTCTGTCGGTGATTCTTCAACGTTTTTCTTTCAGAGGATTCAACGAGAGAGAAACCGTCAGCTTATTCG
GTAATTTCTCACTTTTAGATGTCAGCATC
TCTCTTTGTTTAGCTAAATCTTCTCCGTATTGGGGTATATCACTTCTTGGGAGTGGCTCTCTTTGTGACATGATTCTTTTCTTCTGAATGATCTTAATGCAGGAGCACACAGCATTGGCA
TCACGCATTGCACATTTTTTAAGAACCGCCTCTACAACTTCTCAGCAACCGGGAAGCCTGATCCTGAACTCAATCCAGGGTTCCTCCAAGAACTGAAAACGAAATGCCCCTTCTCTGTCT
CGACTTCATCTCCATCTGCTCCCCCTGACATTGGTTTACCACCGTCCTTACCTGCATCAGATTCCGAAAACAGCTACGGTATGAGCTCAGGAAACAGGAATGATGAAGTGATCGACTTGA
GCTACAACAATGAAGGAGGTGATGAAAATTTTGGAACACGATACTTCCGAAGACTAATGCAGAATAAAGGGTTGATGTCTTCTGACCAGCAACTAATGGGTAGTGAAGTGACTGAGATGT
GGGTGAGGGCATATGCTTCTGATCCGTTGTTGTTCCGCAGAGAATTTGCTATGTCAATGATGAAACTTTCAAGCTATAATGTCTTGACTGGTCCTCTAGGACAAGTGAGAACAAGCTGCT
CAAAGGCCCTCCCCAGGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTCCTCGGAGACTACAAGTTCGCTTTACTTACTTGCTCCGTTATCGCTCTCAGCATCTACTTCGCGATTAACGTCGAATTTCGTTTCGCGTACGATTCACCGGGAACTCGTACC
GGAGTTAAGGTTTCCGAGAAATCTCCCTTCGACGACGAATTCATGTACATGTCAATCGCTGAAGATATCGATCGATCTTACCTCCACTACGATTACTACCGTGAATCTTGCCCTACCGCC
GAGAAAATCATCGCGAAAGCTATCAGAGATATCTACAATGTCACACCCAGCGTAGCTCCGCCTATTATCCGTCTCCTCTTTCACGATTGCTTCATCGAG
GGATGTGATGCATCAGTCCTT
CTAGACGCAGATGAAGCACATACTTCTGAGAAAGATGCATCTCCAAACCTATCCTTGAAAGGGTTTGATGTGATTGACGCCGTTAAGTCTGAGCTAGAGAATGTCTGTCCCGGAGTTGTT
TCCTGTGCTGACCTACTTGTATTGGCAGCTAGAGAAGCCGTCCTAGTT
GCTGGTGGTCCATTCTATCCCCTAGAAACTGGAAGGAAGGATAGTGCAGCAGCCTACAGGGATTTTGCAGAA
CACGAGCTTCCTGCACCAGACGCTACTCTGTCGGTGATTCTTCAACGTTTTTCTTTCAGAGGATTCAACGAGAGAGAAACCGTCAGCTTATTCG
GAGCACACAGCATTGGCATCACGCAT
TGCACATTTTTTAAGAACCGCCTCTACAACTTCTCAGCAACCGGGAAGCCTGATCCTGAACTCAATCCAGGGTTCCTCCAAGAACTGAAAACGAAATGCCCCTTCTCTGTCTCGACTTCA
TCTCCATCTGCTCCCCCTGACATTGGTTTACCACCGTCCTTACCTGCATCAGATTCCGAAAACAGCTACGGTATGAGCTCAGGAAACAGGAATGATGAAGTGATCGACTTGAGCTACAAC
AATGAAGGAGGTGATGAAAATTTTGGAACACGATACTTCCGAAGACTAATGCAGAATAAAGGGTTGATGTCTTCTGACCAGCAACTAATGGGTAGTGAAGTGACTGAGATGTGGGTGAGG
GCATATGCTTCTGATCCGTTGTTGTTCCGCAGAGAATTTGCTATGTCAATGATGAAACTTTCAAGCTATAATGTCTTGACTGGTCCTCTAGGACAAGTGAGAACAAGCTGCTCAAAGGCC
CTCCCCAGGAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTCC TCGGAGACTA CAAGTTCGCT TTACTTACTT GCTCCGTTAT CGCTCTCAGC ATCTACTTCG CGATTAACGT CGAATTTCGT TTCGCGTACG ATTCACCGGG AACTCGTACC  GGAGTTAAGG TTTCCGAGAA ATCTCCCTTC GACGACGAAT TCATGTACAT GTCAATCGCT GAAGATATCG ATCGATCTTA CCTCCACTAC GATTACTACC GTGAATCTTG CCCTACCGCC  GAGAAAATCA TCGCGAAAGC TATCAGAGAT ATCTACAATG TCACACCCAG CGTAGCTCCG CCTATTATCC GTCTCCTCTT TCACGATTGC TTCATCGAGG GATGTGATGC ATCAGTCCTT  CTAGACGCAG ATGAAGCACA TACTTCTGAG AAAGATGCAT CTCCAAACCT ATCCTTGAAA GGGTTTGATG TGATTGACGC CGTTAAGTCT GAGCTAGAGA ATGTCTGTCC CGGAGTTGTT  TCCTGTGCTG ACCTACTTGT ATTGGCAGCT AGAGAAGCCG TCCTAGTTGC TGGTGGTCCA TTCTATCCCC TAGAAACTGG AAGGAAGGAT AGTGCAGCAG CCTACAGGGA TTTTGCAGAA  CACGAGCTTC CTGCACCAGA CGCTACTCTG TCGGTGATTC TTCAACGTTT TTCTTTCAGA GGATTCAACG AGAGAGAAAC CGTCAGCTTA TTCGGAGCAC ACAGCATTGG CATCACGCAT  TGCACATTTT TTAAGAACCG CCTCTACAAC TTCTCAGCAA CCGGGAAGCC TGATCCTGAA CTCAATCCAG GGTTCCTCCA AGAACTGAAA ACGAAATGCC CCTTCTCTGT CTCGACTTCA  TCTCCATCTG CTCCCCCTGA CATTGGTTTA CCACCGTCCT TACCTGCATC AGATTCCGAA AACAGCTACG GTATGAGCTC AGGAAACAGG AATGATGAAG TGATCGACTT GAGCTACAAC  AATGAAGGAG GTGATGAAAA TTTTGGAACA CGATACTTCC GAAGACTAAT GCAGAATAAA GGGTTGATGT CTTCTGACCA GCAACTAATG GGTAGTGAAG TGACTGAGAT GTGGGTGAGG  GCATATGCTT CTGATCCGTT GTTGTTCCGC AGAGAATTTG CTATGTCAAT GATGAAACTT TCAAGCTATA ATGTCTTGAC TGGTCCTCTA GGACAAGTGA GAACAAGCTG CTCAAAGGCC 
CTCCCCAGGA ACTGA 

Retrieve as FASTA