Entry information : AtPrx52 (At5g05340 / PER52 / AtperoxP52 / ATP49)
Entry ID 218
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-05-18 (Christophe Dunand)
Peroxidase information: AtPrx52 (At5g05340 / PER52 / AtperoxP52 / ATP49)
Name (synonym) AtPrx52 (At5g05340 / PER52 / AtperoxP52 / ATP49)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flowers
Mixed tissues
Siliques
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx52
start..stop
S start..stop
BstrPrx47 623 0 1..324 1..324
AlyPrx52 622 0 1..324 1..324
AhalPrx44 620 0 1..324 1..324
AruPrx52 617 0 1..324 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1580595..1580819 225 N° 2 1580293..1580484 192 N° 3 1580038..1580203 166 N° 4 1579142..1579533 392
complement(join(1579142..1579533,1580038..1580203,1580293..1580484,1580595..1580 819))


exon

Literature and cross-references AtPrx52 (At5g05340 / PER52 / AtperoxP52 / ATP49)
Literature REFERENCE 1 Herrero J, Esteban Carrasco A, Zapata JM Arabidopsis thaliana peroxidases involved in lignin biosynthesis: in silico promoter analysis and hormonal regulation.
Plant Physiol Biochem. 2014;80:192-202

REFERENCE 2 Fernández-Pérez F, Pomar F, Pedreño MA, Novo-Uzal E. The suppression of AtPrx52 affects fibers but not xylem lignification in Arabidopsis by altering the proportion of syringyl units. Physiol Plant. 2015;154(3):395-406
Protein ref. UniProtKB:   Q9FLC0
DNA ref. Phytozome 12:   Chr5 (1580819..1579142)
mRNA ref. GenBank:   NM_120616
Cluster/Prediction ref. Phytozome Gene 12:   19665519 UniGene:   At.28537
Omic ref. AtProteome:   At5g05340 ATTED-II:   At5g05340 e-FP Browser:   At5g05340 ePlant:   At5g05340 Genevestigator:   At5g05340 TAIR:   At5g05340
Protein sequence: AtPrx52 (At5g05340 / PER52 / AtperoxP52 / ATP49)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (296)
PWM (Da):   %s   34079.97 (31069.3)  
PI (pH):   %s   8.4 (8.58) Peptide Signal:   %s   cut: 29 range:29-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASNKLISILVLVVTLLLQGDNNYVVEAQLTTNFYSTSCPNLLSTVQTAVKSAVNSEARMGASILRLFFHDCFVNGCDGSILLDDTSSFTGEQNAAPNRNSARGFNVIDNIKSAVEKACPGVVSCADILAIAARDSVVALGGPNWNVKVGRRDARTASQAAANSNIPAPTSSLSQLISSFSAVGLSTRDMVALSGAHTIGQSRCTNFRARIYNETNINAAFATTRQRTCPRASGSGDGNLAPLDVTTAASFDNNYFKNLMTQRGLLHSDQVLFNGGSTDSIVRGYSNNPSSFNSDFTAAMIKMGDISPLTGSSGEIRKVCGRTN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns), 2 cDNA and 4 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGTGGTTAA TATTATATTA AACTTCACAT CCAATGAGCA TTCATGTAAT TTAAAGTAAC TGAAGTTAAG TATCTAGAAG CCTTTTTCTT CTATTGGTTA TTAATTTGCT TAATTTTCTT  TATAAGTTAA TTTCTGGTTG GTGTGAAAAT GTGACCGGAG AAGGTATCTA ACTTTTTTTT TTCTTTAATG AATTCCACTA AAATTTAATT CTGTATGTAA CGCATATAGT AAAATCTAGA  AAGCGACCGG CGTGCCTCCT TTGGAAAGTA ATCCTGTAAA AGTAAAAGCC GCGTAGTGTA AAAGTATATG ACTTCTTCTT CCCATAATTA TTTTATAATT AGTCTTTAAT CTAAATATTT  AAACATATAA TTCGTTTTAC GAGAAAGATC TTCACACTCG ATTAGTATAC ATTACATTTA ATTCCCTAGT TCATAAAATG GATAACAAAA GGCTGTGCGA GATTACAACT GTACTTGATA  ATTTTGTATA AATATATCCT TTATGAATAT ATTTTAGCAT TGATGACCGT ACATGGTTAA TCCAGTCTGC AGCATAACGG AGTATGATAT TAAATGAACA CTTTCTGTTC GTATCAAATG  GTATCGAATA TTATTAGAGT GATCATTCAG AAGAAAAAAA GAGAGAGAAG AAAACCTACA GTGTAAACAT TTTTTTTTTT GCTAAATACC TACAGTGTAA ACATGAAGTG CTATAATTTC  TGCAAATAGA AATCAAGAAC AGAAAGAGTT GCTTGGAGGA AAAGAAATAG AAAATTAAGA AATCTAGTGA TGTAATAAAT CTTTCCATAA AATCAAATGT TTGGTCCAAA GTATTAGTTA  AATAATTAGG CCACTATTCT TGACAACTCT TTTTAACAAA CTCTTCTATA TTTTCTCGTG GTACATATGC TGAAAAAGAT GTATGTCTAA TCCATAATAT ATCTGTATAA TGCGACTTTC  ATTATCTATT AGTACGACTT CTAACCTAGA AGATAACAAG CATTAGTTAG GGCATCAAAA TCAACGTGGA AAAACCTACG AAAAGCACGA AGTGATTAAT CTGTGTAGGG GTGGCGTAAG  GGTAAAGACT AAAGACTGAG AATCTAGGGT TCAAGGCGTA AACTTGTTCT GCTTTTTGGG TTTCATTTTA TTGGCGAACA ACATTGATGT GTGTGGACCA TTTGGTGTTC AGGGATTGAG  ACAAGATAAT ATGTTTGCTC TCACCTTCTA GGATTACTCG GGTGCTAAGA CTCACTTAGT ACTATTGCTA TATCGATATA CTAGTTCATT ACCAAAAAAT GGAGTCTTCA AATTTCGAGT  TCCAATATCT GAAAGCATTG TTTAAAGAGA TTTGTTTTCT CCCTGCACAA TTAGTTTATA ACTTCATATA TACACAATCT TATCAATTTA CAACCAGGTG TGTGTGAACC TTCACATAAT  CTCTCTTATT CATTCATGTA TATATCCAAT AAAAGTTCGA TATGTGAAAT TATATATCTC CATCTAATGT TAGACTATTT CCGGGTCTTG ACTATAAATT TAAAGTATTA GACGAGCTAA  TTATATTTAG CACAAACAAT TTCTTCTGTA ACAGTGTCAC GCTTATCACT ACCAAAGAAT AAACACTGAT CTGTTTTAAT CTCTTATTTT CTCACCCATA TTCAAAGTCA ACTATTGCAA  GACTTCGAGA TAATTAATTT GATGGCTATA CTATTTACTT GACATTTGGG AAAATATATT TTCGCTGATA AATTTGGTTT TTACTTCTCT CTCCGACGGA TATAGAAACA ATTCAATTAC  ATGCGAAAAT GATAATTCAA CCCTATAAAC CAAAACAAAT AACAGAATGC ACATTTTTTT CAACGCGTTA GGTCACCTAT CTTTCACTTT AGAACATCCC TTCACGTCTC TATATAAACC 
TCGACTCTGT TATCCTTTGT TCTTCAAGTA CAACAATCAA CTCTAAGTCT ATTATATTCA AGTCTTTGTT TTAACCTAAC A 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCAAGTCTA CTCCACGTGT CTTTTTCCTA TTGGATTTAC CTTTTATTAT TTGAGTTGGT GAGTATAATA AAGATTGATC TTCTCCAAAA AAATTCGAAG GTCCCTTTCA ATGTTTTTTT  TTTGTTTGCT TTGCTTTGTG TTGAAGTGTG TATTTCCGCA TTAAAAATCT AATGAAAATT ATTCCATTTT GAAGTTTTAT ATTCGCATAT TTTAGAAGTG ATTACGTGTC TAAGTTTTAT  TGGTTATAAT AAATAATTAA TTCTTTGAAG CGGGAGAGAT TTCCTCTGTT TTTAATTACG CGCCAATTAT GTCCCGCGTA TTATCTGTTA AGCGCACGTT AGCAGAAAAT CCATTATCGT  TAAAATGCGC AATTGACACG TAAGCGAACC GATGCCTGAG CTCTCGTGCA CACAACATAG TAAAGAGCGA AAAAGGTTAA AACTTTTGTT CACTGTCAGA AATAGAAAAA ATCGTCGATG  CGCATTAATG GCAATTCGGC CGAGAACTCG TAAAAGAGTT CAAGCTGTTC GTCGTGCTGC CGATGGTAGC GCTTTTAAAA AATGGTATTG CTACTTTGTT CAAAGCTTTT GGATTCGTCG  ATCTAGATTT CTTTAGGGTT TTTATCTAGA TTTGTGATTA CTCTGTTTTG GGTTTTTATT CCAGTGAAGA ATGTGGTGTT ATGATAGCGA TTGCTCTGTA TGATATGCAT GAGTGCGGTG  AGAAAAGAAG GGAAGTGAAA AGGTTCAAGT ACATTGCGAG TGGCAATATC GATAATATCT CGAAACCAAT TGGGAGCTTT GAAGATGAAC CCAGATCACC ATTTGTCTTC TTCTTGTACA  GTAACCAAAG ACTTTTACTC TGTTTCTTAT TACAATTGTG TTGAATTTCT TGAGTTAACT AGATGGAGAT AAATAGTGGA CTTTGATCCT TAGGTCAAAA AAGGGGACTG GTGATGTTAA 
TTTATAAGGT CAATGTCTTT CCTTTTACGT TAAATGTTGG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAAATAAACTTATTTCGATTCTAGTTCTCGTAGTTACACTTTTACTCCAAGGTGATAACAATTACGTCGTCGAAGCACAACTCACGACTAACTTCTACTCAACCTCTTGCCCC
AACCTCCTCTCCACCGTCCAAACCGCCGTTAAATCTGCCGTTAACAGCGAGGCTCGAATGGGTGCATCTATCCTCCGTCTCTTCTTCCACGATTGCTTTGTCAAC
GTAAGTTTTTTTTTC
TTTTACCTTTTTTGTTTTCCTTGCATCTCAAGAAACTTGGCATAATTGTTATTTGGTTATTTCCTTCTAATCATAGTCATAACTTGCATATGTAGGGATGCGACGGTTCGATTCTACTAG
ACGATACGTCAAGCTTCACAGGAGAACAAAACGCGGCTCCAAACCGCAATTCAGCTCGTGGGTTTAATGTGATCGACAACATCAAATCAGCGGTTGAGAAAGCATGTCCCGGGGTTGTGT
CTTGTGCTGATATCTTAGCCATTGCTGCTAGAGACTCCGTCGTAGCC
GTAAGCTCCCTACTTCTCTTAGTCCGATTTTGACAGTTTAAAAGATTAAACCGGTCTAAAATATGAATTCGTC
TTTATATTTGTTGAAGCTTGGAGGACCGAACTGGAATGTGAAAGTAGGAAGAAGAGATGCAAGAACGGCGAGTCAAGCGGCAGCGAATAGTAACATTCCGGCACCGACTTCGAGTCTGAG
CCAACTCATTAGTAGTTTCAGTGCTGTTGGACTCTCCACCAGAGATATGGTTGCTCTCTCTG
GTTCGTTTCATTTCTCCTCTATCTTAACCCAATTCCTATTTATTATATACGCAACTAT
ATATGTTTTATAGATTATGGTTGATTGCAAATTTCAAAACATCGATTACTATTACATTGCTAAAACATTGGGACGACAGAGAAATTTTCTTAATCTGTGATTAATTATCTTTAATTTAAG
AATATTTCTTATTCGTTCACCATATTTGTTTAACTAAAAGAAACATAGAAAGAAATATTTCAAAAGGACCAAGAGTCAACAGAGTCGACACAAAATAATATAATTTGATTATGTTGTTTG
TTTTTTGTCGACTTTACTTTTGTTTCCTTGTGAATTTGTTTTTTCAACACATTTTTGTAACGCACCACCGACTTTTCTGTTTTTTCTTCCCAAAATTACGTAATCATATTTTTCCCAAAG
TTACGTAATCATATAAATGACTGTTAACAAATAAACAAGTCAACTATTAAACTAATCATTCAAATTATTTTTGGTTTTGTTTACAGGCGCACACACGATCGGACAATCCCGTTGCACGAA
CTTCCGAGCGAGAATCTACAACGAGACAAACATCAATGCCGCCTTCGCCACGACACGTCAACGAACTTGCCCTAGAGCCTCCGGTTCCGGCGACGGAAACCTAGCTCCACTAGACGTCAC
CACGGCAGCTTCTTTCGACAACAACTACTTCAAGAATCTCATGACTCAGAGAGGGCTCCTCCATTCCGACCAAGTGCTCTTCAACGGCGGCTCTACTGACTCCATCGTCCGTGGATACAG
CAACAATCCGTCGAGCTTTAACTCTGACTTCACGGCGGCGATGATAAAAATGGGTGATATCAGCCCGTTGACTGGTAGTAGCGGTGAAATCCGCAAGGTTTGCGGGAGGACCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAAATAAACTTATTTCGATTCTAGTTCTCGTAGTTACACTTTTACTCCAAGGTGATAACAATTACGTCGTCGAAGCACAACTCACGACTAACTTCTACTCAACCTCTTGCCCC
AACCTCCTCTCCACCGTCCAAACCGCCGTTAAATCTGCCGTTAACAGCGAGGCTCGAATGGGTGCATCTATCCTCCGTCTCTTCTTCCACGATTGCTTTGTCAAC
GGATGCGACGGTTCG
ATTCTACTAGACGATACGTCAAGCTTCACAGGAGAACAAAACGCGGCTCCAAACCGCAATTCAGCTCGTGGGTTTAATGTGATCGACAACATCAAATCAGCGGTTGAGAAAGCATGTCCC
GGGGTTGTGTCTTGTGCTGATATCTTAGCCATTGCTGCTAGAGACTCCGTCGTAGCC
CTTGGAGGACCGAACTGGAATGTGAAAGTAGGAAGAAGAGATGCAAGAACGGCGAGTCAAGCG
GCAGCGAATAGTAACATTCCGGCACCGACTTCGAGTCTGAGCCAACTCATTAGTAGTTTCAGTGCTGTTGGACTCTCCACCAGAGATATGGTTGCTCTCTCTG
GCGCACACACGATCGGA
CAATCCCGTTGCACGAACTTCCGAGCGAGAATCTACAACGAGACAAACATCAATGCCGCCTTCGCCACGACACGTCAACGAACTTGCCCTAGAGCCTCCGGTTCCGGCGACGGAAACCTA
GCTCCACTAGACGTCACCACGGCAGCTTCTTTCGACAACAACTACTTCAAGAATCTCATGACTCAGAGAGGGCTCCTCCATTCCGACCAAGTGCTCTTCAACGGCGGCTCTACTGACTCC
ATCGTCCGTGGATACAGCAACAATCCGTCGAGCTTTAACTCTGACTTCACGGCGGCGATGATAAAAATGGGTGATATCAGCCCGTTGACTGGTAGTAGCGGTGAAATCCGCAAGGTTTGC
GGGAGGACCAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGTACAACA ATCAACTCTA AGTCTATTAT ATTCAAGTCT TTGTTTTAAC CTAACAATGG CTTCAAATAA ACTTATTTCG ATTCTAGTTC TCGTAGTTAC ACTTTTACTC CAAGGTGATA  ACAATTACGT CGTCGAAGCA CAACTCACGA CTAACTTCTA CTCAACCTCT TGCCCCAACC TCCTCTCCAC CGTCCAAACC GCCGTTAAAT CTGCCGTTAA CAGCGAGGCT CGAATGGGTG  CATCTATCCT CCGTCTCTTC TTCCACGATT GCTTTGTCAA CGGATGCGAC GGTTCGATTC TACTAGACGA TACGTCAAGC TTCACAGGAG AACAAAACGC GGCTCCAAAC CGCAATTCAG  CTCGTGGGTT TAATGTGATC GACAACATCA AATCAGCGGT TGAGAAAGCA TGTCCCGGGG TTGTGTCTTG TGCTGATATC TTAGCCATTG CTGCTAGAGA CTCCGTCGTA GCCCTTGGAG  GACCGAACTG GAATGTGAAA GTAGGAAGAA GAGATGCAAG AACGGCGAGT CAAGCGGCAG CGAATAGTAA CATTCCGGCA CCGACTTCGA GTCTGAGCCA ACTCATTAGT AGTTTCAGTG  CTGTTGGACT CTCCACCAGA GATATGGTTG CTCTCTCTGG CGCACACACG ATCGGACAAT CCCGTTGCAC GAACTTCCGA GCGAGAATCT ACAACGAGAC AAACATCAAT GCCGCCTTCG  CCACGACACG TCAACGAACT TGCCCTAGAG CCTCCGGTTC CGGCGACGGA AACCTAGCTC CACTAGACGT CACCACGGCA GCTTCTTTCG ACAACAACTA CTTCAAGAAT CTCATGACTC  AGAGAGGGCT CCTCCATTCC GACCAAGTGC TCTTCAACGG CGGCTCTACT GACTCCATCG TCCGTGGATA CAGCAACAAT CCGTCGAGCT TTAACTCTGA CTTCACGGCG GCGATGATAA  AAATGGGTGA TATCAGCCCG TTGACTGGTA GTAGCGGTGA AATCCGCAAG GTTTGCGGGA GGACCAACTG ATTCAAGTCT ACTCCACGTG TCTTTTTCCT ATTGGATTTA CCTTTTATTA  TTTGAGTTGG TGAGTATAAT AAAGATTGAT CTTCTCCAAA AAAATTCGAA GGTCCCTTTC AATGTTTTTT TTTTGTTTGC TTTGCTTTGT GTTGAAGTGT GTATTTCCGC ATTAAAAATC 
TAATGAAAAT TATTCCATTT TG 

Retrieve as FASTA