Entry information : GmAPx03 (Glyma12g03610)
Entry ID 2228
Creation 2007-02-14 (Felipe Teixeira)
Last sequence changes 2007-02-14 (Felipe Teixeira)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmAPx03 (Glyma12g03610)
Name (synonym) GmAPx03 (Glyma12g03610)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmAPx03
start..stop
S start..stop
GmAPx04 540 0 1..287 1..287
VuAPx02 524 0 1..287 1..287
LjAPx02 509 0 1..287 1..287
MtAPx02 498 0 1..287 1..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2422420..2422535 116 N° 2 2422146..2422270 125 N° 3 2421747..2421796 50 N° 4 2418741..2418806 66
N° 5 2418604..2418652 49 N° 6 2418379..2418461 83 N° 7 2418210..2418289 80 N° 8 2417974..2418076 103
N° 9 2417292..2417483 192  
complement(join(2417292..2417483,2417974..2418076,2418210..2418289,2418379..2418 461,2418604..2418652,2418741..2418806,2421747..2421796,2422146..2422270,2422420. .2422535))


exon

Literature and cross-references GmAPx03 (Glyma12g03610)
Literature Shoemaker,R., Keim,P., Vodkin,L., Erpelding,J., Coryell,V., Khanna ,A., Bolla,B., Marra,M., Hillier,L., Kucaba,T., Martin,J., Beck,C., Wylie,T., Underwood,K., Steptoe,M., Theising,B., Allen,M., Bowers ,Y., Person,B., Swaller,T., Gibbons,M., Pape,D., Harvey,N., Schurk ,R., Ritter,E., Kohn,S., Shin,T., Jackson,Y., Cardenas,M., McCann ,R., Waterston,R. and Wilson,R. Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm12 (2422535..2417292)
EST ref. GenBank:   AI495918
Cluster/Prediction ref. UniGene:   Gma.6091
Protein sequence: GmAPx03 (Glyma12g03610)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   287
PWM (Da):   %s   31616.34 Transmb domain:   %s   o258-280i
PI (pH):   %s   6.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPVVVDAEYLKEVDKARRDLRALIANRNCAPLMLRLAWHDAGTYDAKTKTGGPNGSIRNEEEYSHGANNGLKKAIDFEEVKEKHPKITYADLYLAGVVAVEVTGGPTIDFAPGRRDSKISPNEGRLPDAKKGVSHLHDIFYRMGLTDRDIVALSGGHTGRAHPERSGFDGPWTEDPLKFDNSYFVELLKEDSAGLLKLPTDKALLEDAEFRRYVELYADEDAFFRDYAESHKKLSELGFVPSSKPISIKDGTILAQGAVGVVVTAAVVIISYLYEVRKRGK*

Retrieve as FASTA  
Remarks Complete from genomic and 47 ESTs. ESTs from GmAPx03 and GmAPx04 have been compile in the same Unigene Gma.6091.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTGCCAGTGGTCGTCGACGCAGAGTACCTCAAAGAGGTCGACAAGGCTCGCCGCGATCTCCGCGCACTCATCGCTAACAGGAACTGCGCTCCTCTCATGCTTCGATTGGCGTAT
GTACTTCTTCTTCTCTCTCTATCGCTTTTATTTTTTCTTTAGTCGAACAATTTCATGTTAATTCTTAGATTTCGAGTTGGTCAACGCTGCGATCGTGCTATTGTGTTTAGTTTTTCTGTG
TTTGAATTAGCTTAATCTGATGCAGCTGGCACGATGCCGGAACTTACGATGCTAAGACCAAGACTGGTGGACCTAACGGTTCGATCCGTAACGAGGAAGAGTATTCTCACGGCGCCAACA
ATGGCTTGAAGAAGGCTATTGATTTCTGTG
GTATGCTTTTTCTTAATTGAGTTAATTCCTTCGCTTTTATCTTTTCCTAAAATTATCATTCAATAATCGTTTTCATTTTGCTAGCTAGCT
AGCATATTTGTGGTTAGGATTTTTAATGCTCCGTCCGTGCTTATCTATTTGCACATACTTTGAGTTATTTGAGTATTGAATAACAACATGACATACAGTCTTGAATTTGATTTGTGTATT
GTCATGGTCGTGCCTTGTGTTGAATCGAACCTATTCCAATTTAACACGCTTAGGATGTTCTAACCAAAATAGTATCATTGGTTGGAACTATGTTGGTCTCCTTGTCTTTCTAAGAGTTGC
TTATTTTCTGATGTCACAGAGGAAGTGAAGGAAAAACATCCTAAAATTACATATGCAGATCTCTACCAGGTGATCATTTGTTTTCATTCAGTTGCTATGAAAGTCTGTAGTGAATCTGAT
AATTTTGTAATGAATTCATTAGGTGAAAATTGTAGAATGGGGTCAATGGACTTTCAAACTTGTCTGGCATGTGCATGATAGTTGATTACGGGTTCCATTTTCGTCCACTATCAATTCAAA
TGACTCTTTTTGTACACTGTTTTTAACTCAAATCTCATGGATGCTGCTGAGGCTTTGGTTTTCCCGTAGTGTTAGGTGGGATTAGTTTATGACTCTTGTTTCTATTTTGTTCCCTGATCA
TGATTGAATTTCAGTATGATGTGGATGGATGAATCTTAAAAGTTACAGACTTAACATGCCAGTGATGTAGTGCCTTGTTACACGTAAGAGTCAAGACTCATCTTCTCATAATGTTTGTCA
ACTCTGATTACTTATGGTTTCAAATTGTGGACCACATCCGATGATGCGGCCACAATAATGTGGGACTTGTTGTTGTAGTTGTGTTCACAATCACATCACACCTTTTGATGTGTTTGAAAA
TCACATTAAGATCTGCAACATAGCACCACAACAGATGCATCACACAGCAATGGGAATCAAAGTCCTCAAACAAATTGTTCTTCATTCTTTCTATTTCTTTACTTAGTAGATTTAAAGTGG
ATTTCGAAGGGTTGGGGAGATTTTAGGATGTTGGTGAATTAAAGGTGGGATTTGGGAGGGAGGAGCAGGAGATGTGGGATTTTGAATGTGAGTCATGATAATTTACGTTCAGTGCAAGCA
TAAAATAAGTTTATACCGCAATGGCCACAATATTGAATCACAAATCACAATAGGTACAATTGCAGTGGCCACAAACATGTCTGCATCCACAACCACAATTTAAAACCAAAGACCACAATT
TAAAACCAAAGACCACAATTGCAAAGAAATTAGCAAACTTTTCCTAGTTATTCAGCTTGTCTGGGATGTTTTGTTCATTTTCTCTATTCTCTTTAAGCATAATAATTTATCTTCTTTTCT
TGTACTTATTTATCTCTATCCTCTAAGAAAATCCCTTTTCTTTCCAAAGACAGCATGGGTTGCTTGTTCTATTTAATTGGATACAGGTTTGCTTTTCTTGGCCTTGTACCTTATCTGTGA
GGTTCCAAGGTTTTTGAAAAGTTGTCAAGGAATTATGCTATGCCTTGAATTTGGGTAAGGGGGCTGTTCTGTGATGGAACCATTTTAAGGGGGAGAGCCCAACTTGATTGCTCTTCTATA
GACTTCATTTTTTGAGCTATTTGTTTGGTTAGTTGCTTTATGTGATTCGAGAGCATATGCATTTTGATGAGATTTTGCTATTGATATTAATAACATGAATTAAAGGAATACAAGTATGAC
CTAATCCCCTAGTTAGAGAACCTTCTCTCTCAACTCCCAATCCAAATCAAATATTCCACACCTACATTATTCTCATTCTCTCCTATCATGATTACCAAACTCTTGAGTTAAGTCGTTAAC
TCTTACAAGTTTACAAGTCCACTTACTCTCTGCGAGTTGACTCATGTGCAAACACTCTTTTTAGTAGACTCGGCGTAGACTCAATGCAAACTCGGTAAACTCTTTAGTTTACCATCGAAC
TAGCGAGTCAGTAAGTTAAAGAAATTAGACCAAAACACAAGTCGTTTTGGGTTGTTTACTGTACGTTTAGGATTCAACATACCTCTATTTAGTGTGTTGCTTCTAAATTGAAGAACCCTC
TCCTCTAACAACATCAAACTTTTATTCTCCAACAACATCAAATCCTCGACGAGAATGCTCTACCACTATTATCATCTCTGCAAGTTATTATCTAGTAGTGATGCATCACTACACTTGGTT
ATTTAAGTATTGTGGAATTTATGATTTACTGTTTTATTTATTATGTTGTTGATATGTTTAATTAGTATGTTATTTATAAGTATTTTGTTATTATTTTTATATGAAGTAGACTCTTACGAG
TCTACGAGTTAAGTTTGTGTCCATGAGTTTCAATAGACTCTCAAGTTTGATAACCTTGGCTCCTATTTAACAGATTCCCCTTTCTCTCTCTGTAACTACTTTCTCTATAACAACCTTCCC
CTTAACTTCTAATTTCTGCCAACAGGCATGTTGGGCTTAAGAGTTTTGGGCCTCTAGGTATAAACCTGGAAAGGCCTACCTATTGTTGATTGCTGGATCCTATCACATTTGCATTCCCCT
TAATCAAATTCTAGCCCTGCCTCCCAATTATTTAAAAGGAACTCATGATCTGTTTCATTCTGCCCAGTGCCCACAAATCTCTATCAGCTCAAAAGGGAGGGGGAACAAATCCCTAAAACA
AGAATTCTGGGTAGCTATATCTATTTTGTATTAGTAGCAGTAATACACCTAGAGGTTGCTAGTTAAGGAGTGTACAGGAGTACAATTGAAGTTCAAGCTTCTATGTAAGTTAATGCAATG
AGTTTCAAGTTTTAATAGCTTAAGCATTTACCTGGTTGTGGTCCAATTCTTTTGTAGCTAGTTTTTGAAATGCATATAGTTAACTTAGTGCCTAGGATTTCTACAATAAAGGTGAATACC
GTTTGATTTTCTTATACACTAATGTACTAATGTTAAAGGTTAGCAAATATCAGCAATTTGATATTCTGAAAATCAAAATTTTCCTTAAGATTACTGAAATAATTTATATCAAAATCAAGC
ATTTACTGGATTTTTGTGTATATCACATACAAGCCATTTAAATCCAATGAGTGCATGAGTCCAGATTCTGTTGAAACAGAGAGGGAGGAGATTATCACTCATTGACAAATAAAAAAATAA
AAAAAATTGATAGGTCATACCTTGTTTAAAACAAGATTTGCATTCATAAGTAGAAACGGACTTAAACTAACTGCCATATAGATTATACAAATCTGATTAAAAATAATTTCTTTGTCCTTG
TGCTTCCAGCTTGCGGGTGTTGTTGCAGTTGAGGTTACCGGGGGTCCCACAATTGATTTCGCTCCTGGTAGAAGGGTATGTTGTGCCATGCCTTTGGTCAGAATATTAATTGTTAGGAAA
TCATCGGATCTTGTTTTGTTAATGTAATTTTCTGTTCTTATAGGATTCAAAAATATCTCCTAATGAAGGGCGGCTTCCTGATGCTAAAAAAGGTGTTTTTAAATTTTTTTCAGTGATAAA
ACTATTCTCTTCACCTGGACTGTGAAAGATGTTCTATTTTTTGTATTCCCTTCACAATGGACGAGGTTATGAATGCGATATGAAAGCATAAAAATATGTCAATGCTGTTGTTAGGTGTTT
CACATCTCCATGATATCTTTTATCGAATGGGCTTGACTGACCGAGATATTGTTGCACTATCTGGAGGACATACACTG
GTAATTCTCCTTTTGTGTAATATCTTTTTATTACTTGCTGTGA
TTATGGCTAGATATTCTTATCTTACTTTCTGTGGTGATCTTATAAGGGGAGAGCACATCCAGAGAGATCAGGGTTTGATGGCCCTTGGACAGAGGACCCTCTGAAGTTTGATAACTCATA
CTTTGT
GTAAGACTTGTGTTGTATGAATGCTATTCATTTTTGCTTTTCTACAAAGGCATTTTGTAGAGCTTCACTTTTGCCTTGCAATACCGAAAGAGTTTGATTTTTATCTACAACTAA
ATATCATCGTTAACATCAGGGAACTTTTGAAAGAAGATTCTGCTGGGCTGCTTAAACTTCCAACAGACAAGGCTTTATTGGAGGATGCTGAATTTCGCCGTTATGTTGAGCTATATGCAA
AG
GTAATTGAGATTAATTCAAATAACCACCGTGTGAAATTTGTTTGACGCTGTGTCCTAATTACCAATTAATGTTTCTCAATAGCATTTCATGGGTCTATTTGTTTACTATAAACACCAT
GAAGCTTGTAATCATATTGCATTAATTATTAGATCAATCTTTTGGCCTGAGGTACCCACTAGGGTTGGCTTAATGGTTGGTCAGGAATTAATAAAACTACGTACTTTGCCAACAATTGAC
TAAACTTTGGTCTTTTTTCCTTCTTTAGACTAATGAAACTAAATAACATGCCTGATAGTGTTAGCACGCACTTGTATGTAGAGTTGTAGAATAACTTATCTAAGACATCAGTGTGAAGTT
TCTATTTTGCTCTAAAGCTATTAAAGAAAATTAAGAGCATACTGTTTTCAGCAAAGTTCTGACTGCTGTCAATGCACCATTGAATTGTGTGAATCTGTCTGCCATCTCATTTTTATACTG
TCATTCTGGCAGGACGAGGATGCATTTTTTCGAGATTATGCTGAATCACATAAGAAACTTTCAGAGCTAGGCTTTGTGCCAAGTTCAAAGCCGATTTCTATTAAGGATGGGACCATACTG
GCACAAGGTGCTGTAGGAGTTGTAGTTACTGCCGCAGTGGTGATCATCAGTTACTTGTATGAAGTTCGCAAAAGAGGGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTGCCAGTGGTCGTCGACGCAGAGTACCTCAAAGAGGTCGACAAGGCTCGCCGCGATCTCCGCGCACTCATCGCTAACAGGAACTGCGCTCCTCTCATGCTTCGATTGGCCTGG
CACGATGCCGGAACTTACGATGCTAAGACCAAGACTGGTGGACCTAACGGTTCGATCCGTAACGAGGAAGAGTATTCTCACGGCGCCAACAATGGCTTGAAGAAGGCTATTGATTTCTGT
G
AGGAAGTGAAGGAAAAACATCCTAAAATTACATATGCAGATCTCTACCAGCTTGCGGGTGTTGTTGCAGTTGAGGTTACCGGGGGTCCCACAATTGATTTCGCTCCTGGTAGAAGGGAT
TCAAAAATATCTCCTAATGAAGGGCGGCTTCCTGATGCTAAAAAAG
GTGTTTCACATCTCCATGATATCTTTTATCGAATGGGCTTGACTGACCGAGATATTGTTGCACTATCTGGAGGA
CATACACTG
GGGAGAGCACATCCAGAGAGATCAGGGTTTGATGGCCCTTGGACAGAGGACCCTCTGAAGTTTGATAACTCATACTTTGTGGAACTTTTGAAAGAAGATTCTGCTGGGCTG
CTTAAACTTCCAACAGACAAGGCTTTATTGGAGGATGCTGAATTTCGCCGTTATGTTGAGCTATATGCAAAG
GACGAGGATGCATTTTTTCGAGATTATGCTGAATCACATAAGAAACTT
TCAGAGCTAGGCTTTGTGCCAAGTTCAAAGCCGATTTCTATTAAGGATGGGACCATACTGGCACAAGGTGCTGTAGGAGTTGTAGTTACTGCCGCAGTGGTGATCATCAGTTACTTGTAT
GAAGTTCGCAAAAGAGGGAAGTAA

Retrieve as FASTA