Entry information : GmAPx07 (Glyma06g12020)
Entry ID 2232
Creation 2006-05-17 (Felipe Teixeira)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmAPx07 (Glyma06g12020)
Name (synonym) GmAPx07 (Glyma06g12020)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation Thylakoid-bound
Tissue type Leaves
Inducer Salicylic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value GmAPx07
start..stop
S start..stop
VuAPx03-2 743 0 20..432 1..412
MtAPx07-B 718 0 1..432 1..436
VvAPx06 689 0 54..432 40..424
GmAPx08 680 0 20..382 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9265978..9266184 207 N° 2 9266286..9266429 144 N° 3 9267771..9267891 121 N° 4 9267968..9268068 101
N° 5 9268157..9268244 88 N° 6 9269598..9269665 68 N° 7 9269758..9269844 87 N° 8 9270833..9270907 75
N° 9 9271034..9271111 78 N° 10 9271199..9271303 105 N° 11 9271801..9271872 72 N° 12 9272174..9272326 153
join(9265978..9266184,9266286..9266429,9267771..9267891,9267968..9268068,9268157 ..9268244,9269598..9269665,9269758..9269844,9270833..9270907,9271034..9271111,92 71199..9271303,9271801..9271872,9272174..9272326)


exon

Literature and cross-references GmAPx07 (Glyma06g12020)
DNA ref. Phytozome 11:   Gm06 (9265978..9272326)
Protein sequence: GmAPx07 (Glyma06g12020)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   433
PWM (Da):   %s   47054.08 Transmb domain:   %s   o412-431i
PI (pH):   %s   7.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERVLLLTPSQSHHSPTTMAVLGGAASARIIPSVSLSTSSRSFFSLSSSSKLKCLRSSPRISHLFLNQQRAEVRVSSGGYGTVSAPKSVASDPDQLKSAREDIKELLNSKFCHPILIRLGWHDAGTYNKNIEEWPLRGGANGSLRFEVELKHGANAGLLNALKLLQPIKDKYSGVTYADLFQLASATAVEAGGPKIPMKYGRVDVSGPEQCPEEGRLPDAGPPSPADHLRQVFYRMGLNDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKEKRDEDLLVLPTDAALFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPLEGIVIDDSPNAGGEKFVAAKYSTGKSELSDSMKQKIRAEYEAIGGSPDKPLQSNYFLNIMIVIAVLAFLTSLLGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 42 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCGTGTGTTACTCCTCACTCCATCTCAGTCTCATCACTCTCCAACCACAATGGCTGTCTTGGGCGGCGCCGCCTCCGCTCGCATCATTCCCTCCGTCTCACTCTCCACCTCT
TCTCGCTCCTTCTTCTCCTTATCATCCTCTTCCAAACTCAAATGCTTGCGCTCCTCTCCTCGCATTTCGCACCTCTTTCTCAATCAG
GTTTTGCCTCGTTCTCTATCTCTGATTACTGCG
ATTCTGATTGTTTATGAAATTTGAGCTTGTTTGCATGAATTGCGCGTGTATTTTTTTTTTTATTTCAGCAAAGAGCGGAGGTTCGCGTTTCGAGTGGAGGATACGGAACGGTATCGGCGC
CGAAGTCCGTTGCGTCTGATCCTGATCAGTTGAAGAGCGCTAGAGAAGACATCAAGGAGCTTCTCAACTCCAAGTTCTGCCATCCTATTCTC
GTAATGTTTGCTTCTTATTTTATTTTAT
TTGTATTGTTTTTCATTTTAAAGATCTCTGTGTCACTCTGTGCTGCTATGTTGCATTTGATTTAGCATTTCCTTTTATTTTTATGTAAACGAAAACTAAACTAAAATAAAACAAGCGAAC
TTTCATTTGTCTGCTCTGCAATTTTATGGAATTGAAGCGTCACAGGATTTCGCGGTACTTTTAAATGCTTTTTCGTCTGGTGAAGAATGTTATTATTAGATAATCATCCTCTACGCATGC
AAGTAAAAAAAATACGTTAAATAATCAAATTCCCTGACCACTGGTTTTTTTTTTCTTTTTGTCAACTTTACTTCTGCTCATGGACTTGCATACTTTATTTATTTAGTTTTTTCTTTTCTT
TTCAAATTGAATTTGTAAAGGCATTTATAATTTTTCCTCTTTAAATTTCATGATCACATTTACAAGTGTTATTGTCATGAAGTACTCCCATATATTAACGTGGAGAGGGACCTCTTACAC
TGTTATTTTGAGATATGAAGTTTTGTTTTTATTGTTGAGTTTTAGCAGTCCCTTTCTTATTCCTTGTTGCTTCATGCAAAATTGTTGTTTATGATACTCTGCAGACTTGGTGGTGTGAAA
CCTCTTCCACTTAGAGTGGTGCAAAGCACCTGTGCAGCACTGGATGTAAAATTGTGATTAGAAACCTAGTAACTTATTCCATATTATGTTTTACGCTCACTTAGAAAGAATAAAAAAAAT
CTGTGTCGGCTATTTAAAGACACCTGGCCTCATCCCTCTCTTTTATTAATATATATTTCAAAGAACTGCCTTCCAAAAAAAAAATATTTCAAAGAACAAAATCTTAACTAACTACTGATC
TGGAATATTCATAAGGAAAATGGTTTGGACTTCCGAATTAAACATAGTCTTTGCAACTTTTTGTCTTCCTATTGGTCCTTTCAGACTTGCAAGTTGCAAATAGCAACAAATGGCCCGAGT
TTGCTGGTTGTGTTGCTGTCTTTCACTTTTGCTGAACCAACCGTATCAGAAGCTTGTAAAGAGGCTGTTAAGTATCAATTGATTGTCAATTCTGACTTCTGAACTAGAGTTTTCAAGGAT
GGTGGATAAACTTTACCATGACTAAGTTAGTCAAGATGTCGAACTCTGATGAACATATGGTCTTCTGGGTTGATGATATATACATGCTGCACGAACTTGAATCTTTATCATTTAATTTTA
GTTTGTACCATAAATGGGACTTGAATTCATGTCATAATTTTTGTTTATTTCATTGATGAGATTTTTTTCTATTTATTTCAATAGTTTACATTACATAAATTTCAATGTGTTAGATTCGTT
TGGGATGGCATGATGCTGGTACATATAATAAGAATATTGAGGAGTGGCCACTGAGAGGTGGAGCTAATGGTAGCTTAAGATTTGAAGTTGAGCTGAAACATGGAGCCAATGCTG
GTAAGG
ATTCATTAAATATTTATCATTTCCATATTTTTCTTATGGAGTAATATTCCCTGATGAACTTCCATATCAGGACTTTTAAATGCATTGAAACTTCTTCAGCCGATCAAAGACAAATATTCT
GGTGTGACATATGCAGACTTATTTCAGTTGGCTAGTGCTACGGCTGTGGAG
GTTATCTTAGTCCTATTTTGGCTTCAGTACTGACTATTGTTTATTTGAATTAATTGGATGATACAGTGT
CCACTTTTTGGAATTTCAGGAAGCTGGAGGCCCCAAAATCCCTATGAAATATGGAAGAGTGGATGTATCTGGACCTGAACAATGCCCTGAAGAAGGGAGACTTCCTGGTAATAACCATAT
ATTATGTGGGAGCTTAATTGTTATAGAAATCTCTCTTCTTTTCTTCTCAGTTGGCTGTAGGACCTGGATTGAGTAATCTACTGTTAATTTGGGAATAAAAAAAATAAGAGAAACAAATAG
CTATTCATTTATAAGGTATCTATTAACAAAATTGTTTTATCATTTGAAGGTGCAAGAAATGTGAGGTTATTTAACTAACAGATGGTCACTTTGAGCTGCTAGGTTCTTTAAGACATCTTG
GATGTGCAGACCTGATTATCCTGTCCTGATTCCATAGATATGAGTAATTGATTGCACAACTATGTATAAATGTGCTCATTTAAAGTAAGGAGTCTTAAGTAAATTTGATAATGGTTTTTT
TTTGGAGAGTTTTATTGACTCTACGATTCTTAGAATTCCTTAGGTATGTTTATTGTGGTTATTTATTATGTGTAATGCGTATTACTTATTCTCCCTAGTAAAGACTACTAGCAGAATGGT
TATTGCTTCTCTAAATACTCTAGTGTTTTTCTGGGGAGGGGGAATTCCTCCTTGTTTGGTTATCAATTGAATAAAATAAATAAATTTTTAGAAAGAAAGATGCGAAGGGTTGTGATCAAT
TTTTTTAGTCATACAAAGATGCCCCAGGATATTAGCACACTATTTATCCTCCAGTTGTAAGTTTCACTGATTAGCACTATAGTTATCAGCCAACTATAGGTAGGGTGTACATGGACTGGT
TTGGACCTGAACCCAAGCCAACAATTTCTCACATCCTCCAAATTGAAGAATTGCAAACCAATTAGACCAAAACATGAAAATGAAGGTTTGGCTAGTTTTTGGGAGTAGACCTTTTCATGT
CCTCTTACAAATTACCATCTCAAATGGTATATATGTGCCTAGTGAGTATTGAATGGAAAAATAACCATAGTGTTAGATAAACATTCAACAATCAGTTCGGTACAATGAAGCCAGATTTTA
AATACATTCTAGTTCTATTCTAATTAGTTTTTGAGCCCGAACTTGCTCAAAAGAAACAAAATATAAAGTTTATACTAACCATTTTAGTTAAATAAAAAGTTTCCCTACTTCTCATTTACA
TTAAGATACATCAATATAGTTTGAATTTGAACTAGTTTAATATCAATATTTTAAAATTTATATTGTTGAAGGTAGCTAATATGCAAATGTAGATGTTTTCAACTTGAAAGCTAAAATCAG
TCTGTTTAGATGACACATTCTTTTGTTCCTTGCAACAGGATAATTGTGACTTAATTTAGGATAGTTTATCCTACATTGAAAAGCACTTCCTTTTTCAAACATTGTCAATTGACTAACTTC
TAGATATTTTTGGTATTTAGATGCTGGGCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTACCGTATGGGTTTGAATGACAAGGTAAATTTCCTTTGTGTCCCTGAAGAATAAAG
GTAGTATATTGGATTATAGTCATATGTCAGATTTTGACTTTTAAGTTACTGTTTCTGCAGGAAATTGTTGCATTATCTGGTGCACACACACTGGGGCGGTCTAGACCAGATCGCAGTGGT
TGGGGAAAGCCTGAAACTAAATATACG
GTATATTATCTTCCTTTTTGCCTACAACTTATAGGAAATTATTTTGTAAAAGTCTTTGAACTCTTTTGAAAGTTGAAACCGTATTTTCCCATT
TTAATTTTACTATTTAATACTGTAATTCCCTTGGGCACTATATAGGCTGTAGGTAACAATCAGAAGTATAGATATTATGTTGTATGTTAAAACTTTTGGTTACTCATGTAGAAGATGACC
ACTTAAGCTCTTTCTCTCATTGCATAACTTAATTCCCACACAACAATTTAAAGACACTTGACTGTGTATTTTTGAAATGATTGATAAAAAGATAATGTGTGCCACAAATATTTGAAGACT
CTAGATTCATGTCAATTTTCTGACTTTCTTACTGTGATACGTCCAAGTTCCTCATATGCCTCACCTTGAGGATTTTCTTAATAATTTAAGTTTGTGATTTAAATATTGATTGTGGTTTCT
ACTTTACAAACAAGAGTTTTGCATGTGCTCTAAATAGATCTTTACGGCTTATTTCTTTCTTGGTTCACCATATAAACAATTGTTTTCTGTTGCACTTTGAAATGAATGCTTGATGAAATG
GAATTTCAAGGGACACTGCAACTACATATTAGTTCATTGTTGAAATCGTCGTCATCATCATCATCAAGGTTTTTTTTAACCAATCACTCTGTTTAGGAGAGGAAGCATTATTGATGCAGC
ATCTTTAGTAGCCTAGCCTGAATTTTAGCTAGTGTGGTATTTGCTGAAAATCAACTAGTTTTCAATTATAGTTTTACTTGAGCACAATAAAACAGCAGGAAATTCACATGCATTTCTCAC
TGTTAAAATATTGTGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCTCACTCTACAGAAAGATGGGCCAGGAGCACCCGGAGGACAATCCTGGACAGTGCAATGGTTGAAATTTGACAACTC
CTACTTCAAG
GTCAGAAATATATACTTTTTTCTTTTGCCGGGGAGGGGGTAGGGCATTCTATAAGGGAGAGTGGTAGAGGAGAGGGGAGTTTGCTAGAATTTACCCTTTTCTTTTTGCAA
CTGTTGTTACATACAGGACATCAAAGAAAAAAGGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTTTTTGAAGACCCATCCTTTAAGGTAATGTATCTGGAGTTTTATTTCAT
GGCTATTAATGCAAAAGTTTTGTGATATACCAAAATAACAAAAACTTTGTGAAATAATCAGGTATATGCTGAGAAATATGCTGAAGATCAGGAAGCATTCTTTAAAGATTATGCTGAAGC
CCATGCTAAACTTAGCAACCTAGGAGCCAAATTTGATCCTCTAGAG
GTATGTTCATTTTGAGTTACTGTTACTGTGTTTTACAAATTAAGATTAAGATAAGGCTTAAATACATTTTTCGT
TTCTGCAATTTAGCACTTTATTCATTTTCATCCTTGCAATTTTTTTTCTTCATTTTAGTCCTCGCAAAATGTGTTTGTTTTGTTTTTCGTCCTTAAAGTGCTCTAGAGTATGCTTTTTTT
TACTGTTCAAAGCGCTTTCTAAAGCGCTTTAAAGACGAAAAACAAAACAAACACATTTTGCAAGGACTAAAACAAAAATAAAATTGGAAGGGAAAAAATAAAAAAATGATAAATTGCAGG
GACAAAAAAAGTATTTAAGCCTTAAGATAACTATGATTGTGTGACCAATGGCCTGGAGATTCGGTTCTTGTGGACTTAACTTTGATATCCTTTTCTTGTCATGTCTGTGTGCATATTCTT
ATAAATAACAAGACAATTGACCTAGTTACCAACTAAGAATTTCCTTTGCTATCTCTTTGTCAGGGCATTGTGATAGATGATTCTCCAAATGCAGGGGGAGAGAAGTTTGTAGCAGCCAAG
TACTCCACTGGAAAG
GTTCTTATCTTGCGCAATTTATCAAATCTTACTGTTCATTTAATTGATACTCACAGAAAATTTATTGGATATTTTTCAATTAAAGACTTGCATAGGATGTATATT
TGTATATTGTTCATTGTTTTACTTTTCCTGGTTTGGTGCAGGAATAGAAACAAGTGTCATGTTTTCTTGTGCCAGTATCTTTTAGTAATACAAGAAGACGCTATTTTCAAATCATGTGAT
ATCGCATGTAAAATTTCGAAGTTTTAAATGAAGAAGAAAGGAATAAAATTCAATAGTGTGCCTATTTGAATTGCAGAGTGAGCTGTCTGACTCTATGAAGCAGAAGATACGGGCTGAATA
TGAAGCAATTGGTGGAAGCCCAGATAAGCCTCTACAGTCAAACTATTTTCTAAATATCATGATTGTTATTGCTGTTTTGGCATTTTTGACATCACTGCTTGGAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCGTGTGTTACTCCTCACTCCATCTCAGTCTCATCACTCTCCAACCACAATGGCTGTCTTGGGCGGCGCCGCCTCCGCTCGCATCATTCCCTCCGTCTCACTCTCCACCTCT
TCTCGCTCCTTCTTCTCCTTATCATCCTCTTCCAAACTCAAATGCTTGCGCTCCTCTCCTCGCATTTCGCACCTCTTTCTCAATCAG
CAAAGAGCGGAGGTTCGCGTTTCGAGTGGAGGA
TACGGAACGGTATCGGCGCCGAAGTCCGTTGCGTCTGATCCTGATCAGTTGAAGAGCGCTAGAGAAGACATCAAGGAGCTTCTCAACTCCAAGTTCTGCCATCCTATTCTC
ATTCGTTTG
GGATGGCATGATGCTGGTACATATAATAAGAATATTGAGGAGTGGCCACTGAGAGGTGGAGCTAATGGTAGCTTAAGATTTGAAGTTGAGCTGAAACATGGAGCCAATGCTG
GACTTTTA
AATGCATTGAAACTTCTTCAGCCGATCAAAGACAAATATTCTGGTGTGACATATGCAGACTTATTTCAGTTGGCTAGTGCTACGGCTGTGGAG
GAAGCTGGAGGCCCCAAAATCCCTATG
AAATATGGAAGAGTGGATGTATCTGGACCTGAACAATGCCCTGAAGAAGGGAGACTTCCTG
ATGCTGGGCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTACCGTATGGGTTTG
AATGACAAG
GAAATTGTTGCATTATCTGGTGCACACACACTGGGGCGGTCTAGACCAGATCGCAGTGGTTGGGGAAAGCCTGAAACTAAATATACGAAAGATGGGCCAGGAGCACCCGGA
GGACAATCCTGGACAGTGCAATGGTTGAAATTTGACAACTCCTACTTCAAG
GACATCAAAGAAAAAAGGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTTTTTGAAGACCCA
TCCTTTAAG
GTATATGCTGAGAAATATGCTGAAGATCAGGAAGCATTCTTTAAAGATTATGCTGAAGCCCATGCTAAACTTAGCAACCTAGGAGCCAAATTTGATCCTCTAGAGGGCATT
GTGATAGATGATTCTCCAAATGCAGGGGGAGAGAAGTTTGTAGCAGCCAAGTACTCCACTGGAAAG
AGTGAGCTGTCTGACTCTATGAAGCAGAAGATACGGGCTGAATATGAAGCAATT
GGTGGAAGCCCAGATAAGCCTCTACAGTCAAACTATTTTCTAAATATCATGATTGTTATTGCTGTTTTGGCATTTTTGACATCACTGCTTGGAAACTAG

Retrieve as FASTA