Entry information : GmAPx08 (Glyma04g42720)
Entry ID 2233
Creation 2006-05-17 (Felipe Teixeira)
Last sequence changes 2012-06-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-06-06 (Christophe Dunand)
Peroxidase information: GmAPx08 (Glyma04g42720)
Name (synonym) GmAPx08 (Glyma04g42720)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation Stromal
Tissue type N/D
Inducer Salicylic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value GmAPx08
start..stop
S start..stop
GmAPx07 681 0 1..365 20..382
VuAPx03-1 662 0 1..366 1..364
VuAPx03-2 662 0 1..365 1..363
MtAPx07-A 634 0 9..366 25..387
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48413969..48414124 156 N° 2 48413731..48413874 144 N° 3 48413032..48413152 121 N° 4 48412855..48412955 101
N° 5 48412678..48412765 88 N° 6 48410614..48410681 68 N° 7 48410435..48410521 87 N° 8 48409494..48409568 75
N° 9 48409282..48409359 78 N° 10 48409083..48409187 105 N° 11 48408814..48408885 72 N° 12 48408662..48408667 6
complement(join(48408662..48408667,48408814..48408885,48409083..48409187,4840928 2..48409359,48409494..48409568,48410435..48410521,48410614..48410681,48412678..4 8412765,48412855..48412955,48413032..48413152,48413731..48413874,48413969..48414 124))


exon

Literature and cross-references GmAPx08 (Glyma04g42720)
DNA ref. Phytozome 11:   Gm04 (48414124..48408662)
Protein sequence: GmAPx08 (Glyma04g42720)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367
PWM (Da):   %s   39818.22  
PI (pH):   %s   8.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLGAASSSARIIPSVSLSSSSRSFFSLSSSSSKLQCLRSSPRISHLFLNQRRAEVRVSSGGYGTVSAPKSVASDPDQLKSAREDIKELLNSKFCHPILIRLGWHDAGTYNKNIEEWPQRGGANGSLRFEIELKHGANAGLVNALKLLQPIKDKYSGVTYADLFQLAGATAVEAGGPKIPMKYGRVDVSGPEQCPEEGRLPDAGPPSPADHLRQVFYRMGLNDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKEKKDEDLLVLPTDAALFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPPEGIVIDDSPNAGAEKFVAAKYSTGKE*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 31 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCTTGGGCGCCGCCTCCTCCTCCGCTCGCATCATTCCCTCCGTCTCACTCTCTTCCTCTTCTCGCTCCTTCTTCTCACTCTCATCCTCTTCTTCCAAACTCCAATGCTTGCGC
TCCTCTCCTCGTATTTCGCACCTCTTTCTCAATCAG
GTTTTCCCTCTCTCTCTGAATGCCGCAATTCTGATTGTTTCTAGAATTTGAGCTTTTTTGCGTGAATCGCGCTTGTGATTTTTA
TTTTTATCAGCGAAGAGCGGAGGTTCGCGTTTCGAGTGGAGGATACGGAACTGTGTCGGCACCGAAGTCAGTTGCGTCTGATCCTGATCAGTTGAAGAGCGCCAGAGAAGATATCAAGGA
GCTTCTCAACTCCAAGTTCTGCCATCCTATTCTC
GTAATGTTCGCTTCTTTTTTATTTATTTTTTGTTTTTCATTTTAAAGATCACTGTGCTGCTTTGTTGCATTTGATTTAGCATTTCA
TTTGATTTTAATGTAAACAAAATTAAATTAAAATAAAACAAGCGAACTTTCATTTGTCTGCTCTGCGTTTATGGAATTGAAGCGTCACAGGATTTCGCGGTACTTTCGAATATTTAGTCG
TTTGGTGAAGAATGCTATTATTAGATAATCATCCTCTGCGCATGCAAGTATAAAATTCGTTAAATAATCAAATTCCGTGACCGCTGGTTTTCTTTCTTTTTTTGTTGTTGTCACGTTTAC
TTCTGCTCATGGACTTGCATACTTTCTTGATTTTAGGGTTTTGGATTTTTTTTTTCAAATTGAATTTGTAAAGGCATTTATAAATTTTTTCCTCTTTAAATTTCATGATCACAAGTGTTA
TTGTCATGAAGCAGTTTCATCTATCAATGTGGAGATGAACCTCTTACATTATAACTTTTGTTTGTTTCATTGATGAGATTTTTTTTCTTCTATTTATTTCAATAGTTTACATTACATAAA
TTTCAATGTCAGATTCGTTTGGGATGGCATGATGCTGGTACTTATAATAAGAATATTGAGGAGTGGCCACAGAGAGGTGGAGCTAATGGTAGCTTAAGATTTGAAATTGAGCTGAAACAT
GGAGCCAATGCTG
GTAATGATTCATTAAATATTGATTATTTCCGAATTTTGCTTATGGAGTAATATTCCCTGATGAATTGTCATATCAGGACTTGTAAATGCATTGAAACTTCTTCAGCC
GATCAAAGACAAATATTCTGGTGTGACATATGCAGACTTATTTCAGTTGGCTGGTGCTACAGCTGTGGAG
GTTATCTTAGTCCTATTTTGGCTTCAGGACTGACTATTGTTTATTTGAAT
TAATTGGATGATACATTGATCACTTTTTTGGAATTTCAGGAAGCTGGAGGCCCAAAAATCCCTATGAAATATGGAAGAGTGGATGTATCTGGACCTGAACAATGCCCTGAAGAAGGGAGA
CTTCCAG
GTAATAACCATATATCCTGTGGGAGCTTAATTGCTATAGAAAACTCTCTTCTTTGCTTATCAGTTGGCCGTATGACCTGGATTGAGTAATCTACTGTTAATTTTGGAATAAAA
AAAATAAGAGAAACAAATAGCTATTCATTTATAAGATATCTATTAATAAAATTGTTTTAGCATTTGAAGATGCAAGAAATGTGAGGTTATTTAACTAGCAGATGGTCACTTTGAACTTCT
GGGCTCTTTAAGACATCTTGGATGTGCAGACCTGATTATCCTGTCCCGATTCCATAGATATATGTAATTGATTGCACAACTATTAAATTTGACTGCATAATGTGCTCATTTAAAGTAAGG
AGTCTTGAGTGAATTTGACAATGGTTTCTTTTGGAGAGTTTTATTGACTCTAGGATTCTTAGAAATCCTCAGGTATTTTTGTGTGGTTATTTATTATGTGTAAATGTGTAATGCATATTT
ACTTATTCTCCCTAGTAATGACCGCTAGCGGAATTGTTATTGCTTCTTTAAATACTGTAGTGTTTTTTTTTGGGAGGGGGGATTCCTCCTTGTTTGGTTATCAATTAAATAAAATAAATA
AATTTTTAGAAAGAAAGATGCAAAGGGTTGTGATCCATTTTTTTTAATCATACAAAGATGCCCCAGCATATTAGCACACTATTTATCCTCCAGTTATAGGTTTCACTGATTAGCACGATA
ATTATCAGCCAATTATAGGTAGGGTGTACATGGACTGGTTTGGACCTGAACCCAAGCCAACAATTTCTCACATCCTCCAAATTGAAGAATTGCAAACCAATTAGCCCAAAGCATGAAAAT
CAAGGTTGGGCTAGTTTTTTGGAGTAGACCTTTTTCATGTGCCCTTCCAAATTACCATCTCAAATGGTATATATGTGCCAAGTTAGTGAAAATTTACTGCTACTGAATTAGTGAGTTTTA
ATCATAGTGTTTCTTCTATAAAAACATCAAATAGGAAGAGGTGACACCAAAGAAATGTTAGATAAACCTTCAACAATCAGTTTGATACAACGAAGGCAGATTTTAAATATATATTAGTTC
ATATCTAATAAGTTTTTGGGCCTGAACTTGCTCAAAAGAAACAAAATATAAGCTTTAAACTACCATTTTATATTTAAATAAAAAGTTTCCCTACTTCTCATTTACATTAAGATACATTAA
TGTTAAACAATCAACATTTAATATTAAACTAGTTCAAACTCAAACTATAGACTAATTAAACATATTTTGAAAACTGATAGTAGTAGTGTAGAAAGGGAACATTCATGGGCTGATAAGATA
TAACGGACTGCTTACACATTCTGCCATTCTGTCACATTGATGTTTAAACAATGAACAGTTTAATGTTAAACTAGTTCAAACACTAGGGCTAATAAGAGATAAGGGAATTGCTTAATTAAA
AATACTTTGCAAACTGAGTGAATATAAAAGTGAGGAAAAATAAAAACTTGACTTTCGTGGGCTAACAAGAGATAAGGGAATTGCCTTTTTTAACTTCTATTAATGCATTCTGCCATTCTG
GTATTTCATGCTTCACAGCCAACAAAGGGTATCTATCTTGGCTTTTAGTAAGTAGGTAAGTTTAAAATCTTTTATTACACAAATTCAAAACCTGCCCCAACCTGACAAAAGTATCATTTG
GATTTAGTTACTTTAGTTTTTCAGACCTTTTGGGTTTTGAACAGCCCCAGCTATAGGACTTTATTGATCATTGACCAGAAATTCAACTATGAAAACGACAGCAAAATTCTTATACCCATA
ATTGGTAGTCAGTCAAGACTTGAGCTAGTCACATTTTAAATTTTATATTGTTGAAGATATGTAAATGTAGATGTTTTCAACTTGAAAGCTAAAATTCTGTCTGTTTAGATGACATTCTTT
TGCTCCTTCAACAGGATAATTGTGACTTAATTTAGGACAGTTTATCCTACATTGACTAACTTCTAGATATTTTTGGTATTTAGATGCTGGTCCCCCTTCACCTGCTGATCATTTGCGTCA
AGTTTTCTACCGTATGGGTTTGAATGACAAG
GTAAATTTCCTGTGTGTCCCACAAGAATAAAGGTAGTATATTGGATTATAGTCCGATATCAGATTTTGACTTTTAAGTTACTGTATCTG
CAGGAAATTGTTGCGTTATCTGGTGCACACACATTGGGGCGGTCTAGACCAGATCGCAGTGGTTGGGGAAAGCCTGAAACTAAATATACGGTATATTATCTTCCTTTTGCCTGCAAGTTA
TAGGAAATTATTTTGTAAAAGTGTTTGAACTCTTTTCGAAGTTAAAACCGTATTTTCCAATTTTAATTTTAATATTTGATGCTGTAATGCCCTTGAGCACTATAGGCTGTAGGTAGCAAT
CAGAAGTATAGATATTATGTTGTATGTTAAAACTTTTTATTGCTCATGTAGAAGATGACCACTTAAGCTCTTTCTCTCATTGCATAACTTAATTCCCACATAACAACTTAAAGACACTAG
GCTGTGTATTTTTGAAATGATTGATGAAAAGATAATGTGTGCCACAAATATCTGAAGACTCTAGATTCATGTCAATTTTGTGACTTTCTTACTGTGTTTTTACCCAATCACCAAACGTCC
GTTAGTGTTTTCTGCAAGGTGTCCAAGTTCCTCATATGCCTCTCACCTTGAGACTTTTCTTACAAGTTTCTGATTTAAATATTGATTGTCTTTTCTACTATACAAATAAAAAGTTTTGCA
TGTGCTCTAAATAGATCTTTGTGGCTTAATTCTTTCTTGGTTCATTGTAAATACAATTGTTCTCTGTTGCACTTTGAAATGAATACTTGATGAAAGGGAATGTCAAGGGGCACTGCAAGT
ACATATTAATTTATGGTTGAAATATTCTTCATCATCATCATCATCATCATGGTTTGTTTTAATCAATCACTCTGTTTTGGAGTGGAAGACATTATTGATGCAGCATCTCTAGAGGTCTAG
CCTGAATTTTAGCTAGTGTGGTATTGCTGATAATCAACTAGTTTTCAATTATAGTTTTACTTAAACACAATAAAACAGCAGGAAATTCACATGTATTTCTCACTCTCACTCTACAGAAAG
ATGGACCAGGAGCACCCGGAGGACAATCCTGGACAGTGCAATGGTTGAAATTTGACAACTCTTACTTCAAG
GTCAGAAATATATATATATATATAGCTTTTTTTGGCAGGGAGGGGGTAG
GGTGTTCTATAAGGGAGAGTTGTAGAGGAGAGTGGAGTTTGCTAGAATTTACTGTTTTTTTTTTTGTAACTGTGGTTACATACAGGACATCAAAGAAAAAAAGGATGAAGATCTATTGGT
ATTGCCAACTGATGCTGCTCTTTTTGAAGACCCATCCTTCAAG
GTAATGTTTCTTGAGTTTTATTTCATGGCTATTACAATTAAATGCAAAAGTTTTGTGATATAACAAAATAACAAAAA
CTTTGTGAAATAATCAGGTATATGCTGAGAAATATGCTGAAGATCAGGAAGCATTCTTTAAAGATTATGCTGAAGCCCATGCAAAACTTAGCAACCTTGGAGCCAAATTTGATCCTCCAG
AG
GTCTGTTCATTTTGAGTTACTGTTACGGTGTTTTACAAATTAAGGTAGTTATGATTGTGTGACCAGTGATCTGGAGATTTGGTTCTTGTGGACTTAACTCCGTTACCTTTTTTGTCTC
ATGTCTGTGCATATTCAAGTAAAAAACGAGACAATTGACCTAGTTACTAAGTAAGAATGTTCTTTGCTATATTTGTCAGGGCATTGTGATAGATGATTCTCCAAATGCAGGGGCAGAGAA
GTTTGTAGCAGCCAAGTACTCCACTGGAAAG
GTTCTTATCTTACACAATTTATCAAATCTTACTATTCATTTAGTTGACATTCAGAGAAAATTTATTGCATATTTTTCCGTTAAAGACTT
GCATAGGATGTATATTTGCATATTGTTCATTGTTTTACTTTTCCTGGTTTGGTGCAGGAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCTTGGGCGCCGCCTCCTCCTCCGCTCGCATCATTCCCTCCGTCTCACTCTCTTCCTCTTCTCGCTCCTTCTTCTCACTCTCATCCTCTTCTTCCAAACTCCAATGCTTGCGC
TCCTCTCCTCGTATTTCGCACCTCTTTCTCAATCAG
CGAAGAGCGGAGGTTCGCGTTTCGAGTGGAGGATACGGAACTGTGTCGGCACCGAAGTCAGTTGCGTCTGATCCTGATCAGTTG
AAGAGCGCCAGAGAAGATATCAAGGAGCTTCTCAACTCCAAGTTCTGCCATCCTATTCTC
ATTCGTTTGGGATGGCATGATGCTGGTACTTATAATAAGAATATTGAGGAGTGGCCACAG
AGAGGTGGAGCTAATGGTAGCTTAAGATTTGAAATTGAGCTGAAACATGGAGCCAATGCTG
GACTTGTAAATGCATTGAAACTTCTTCAGCCGATCAAAGACAAATATTCTGGTGTGACA
TATGCAGACTTATTTCAGTTGGCTGGTGCTACAGCTGTGGAG
GAAGCTGGAGGCCCAAAAATCCCTATGAAATATGGAAGAGTGGATGTATCTGGACCTGAACAATGCCCTGAAGAAGGG
AGACTTCCAG
ATGCTGGTCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTACCGTATGGGTTTGAATGACAAGGAAATTGTTGCGTTATCTGGTGCACACACATTGGGGCGGTCT
AGACCAGATCGCAGTGGTTGGGGAAAGCCTGAAACTAAATATACG
AAAGATGGACCAGGAGCACCCGGAGGACAATCCTGGACAGTGCAATGGTTGAAATTTGACAACTCTTACTTCAAG
GACATCAAAGAAAAAAAGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTTTTTGAAGACCCATCCTTCAAGGTATATGCTGAGAAATATGCTGAAGATCAGGAAGCATTCTTT
AAAGATTATGCTGAAGCCCATGCAAAACTTAGCAACCTTGGAGCCAAATTTGATCCTCCAGAG
GGCATTGTGATAGATGATTCTCCAAATGCAGGGGCAGAGAAGTTTGTAGCAGCCAAG
TACTCCACTGGAAAG
GAATAA

Retrieve as FASTA