Entry information : AtGPx07 (At4g31870 / ATGPX7 / GPX7)
Entry ID 2250
Creation 2006-06-14 (Marcia Pinheiro Margis)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: AtGPx07 (At4g31870 / ATGPX7 / GPX7)
Name (synonym) AtGPx07 (At4g31870 / ATGPX7 / GPX7)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtGPx07
start..stop
S start..stop
AlyGPx07 404 3e-145 1..233 1..236
BnGPx01_other 366 2e-130 18..233 21..236
BnGPx07_other 363 2e-129 4..233 5..232
BoGPx07_other 360 4e-128 4..233 5..232
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15410205..15410450 246 N° 2 15410636..15410712 77 N° 3 15410809..15410870 62 N° 4 15410968..15411086 119
N° 5 15411168..15411335 168 N° 6 15411588..15411617 30  
join(15410205..15410450,15410636..15410712,15410809..15410870,15410968..15411086 ,15411168..15411335,15411588..15411617)


exon

Literature and cross-references AtGPx07 (At4g31870 / ATGPX7 / GPX7)
Literature Glutathione peroxidase genes in Arabidopsis are ubiquitous and regulated by abiotic stresses through diverse signaling pathways (2003). Milla, M. A.,Maurer, A.,Huete, A. R.,Gustafson, J. P. THE PLANT JOURNAL 36:602
Protein ref. UniProtKB:   Q9SZ54
DNA ref. Phytozome 11:   Chr4 (15410205..15411617)
Cluster/Prediction ref. Phytozome Gene 11:   19648027 UniGene:   At.54571
Omic ref. TAIR:   At4g31870
Protein sequence: AtGPx07 (At4g31870 / ATGPX7 / GPX7)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   233
PWM (Da):   %s   25687.18  
PI (pH):   %s   10.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSYASFSTPFNGFAANPSPITSAFLGPSLRFSTRTSKTRNPSNGVSVKSSNSHRFLVKSKNFSVYARAAAEKSVHDFTVKDIDGNDVSLDKFKGKPLLIVNVASRCGLTSSNYSELSQLYEKYKNGFEILAFPCNQFGGQEPGSNPEIKQFACTRFKAEFPIFDVDVNGPSTAPIYKFLKSNAGGFLGDIIKWNFEKFLVDKKGKVVERYPPTTSPFQIEKDIQKLLAA*

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 4, 4 introns), 1 cDNA and 2 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAACATGAAT CACCAAAAAG GTTCAGCTAT ATCAGTCTAC AAGCTCTTAA ACCAAGTTTT AAGCCGGAGA AAATACACCA AGAAGACAAA TGTTTCCTTT TTTACCTCCA TGACCATCAT  AGACACCCAA GAAGGAAGTG TTATCATCGA GATCAAGTAT TGCAGCATGC TACCAAAGTT ATAAAAAAAA AACATTCTTT GAATCAGTAA GGAAACAAAA TCTGACAAAA AGAAGAAAGG  TTTAAACTTT TTGATGATAA TCACTCACAG CATCTTCCAT GGACGCACGC CAACCTTGCA TAGAGGATAA ACCATATCTG AGTTTATGAT TTTCGCCATC TTCTGAGAAC TTGTCTGTTT  TTGGAGTACT TAGATATATA CCCATCTCTC TCTGCAACGA AAAAATTAGA CATTTCTTCA TGAATCAAAA AAAGAAACTA TTCTTGATTA CAAAAACAAA ATCAAAAGAG AATTTTGACA  ATGGACCCCT GTGATCTTAA TCTTTTAGAG CTAATTAAGA AATCAATCTA CAAACAGAAA CCAAAACAGA GAGGGCTGAA TCGATAAGAG TTTTAAACAT ACCAAGATTT GAAAACGTCA  AAAGGAAGTA GGTGATGAAG TTGTACGAGA AGCTTGGTTT CCTCACATAT CTGGCTGGAG AAAGGAAAGA CCTTTGGTAG GAGACAGTTT TGATTAGAGG AAGACGAAGA AGAAGAAAGT  TTTGATTTGG GATCAAATTC AGATTGTCGT AGCCCCAAAA AGAAGAAGAA GAGAAAAAGT CTGTTTTGTT TTGCCTTAGA AAAGCAACGA AAGTTCTTAA GATTTTGTTC GTGTTCTCTT  ACTTGCCAGC ACAACACACT ATTTTTACTT AACACTAATA CAATAATGTA TTACCTGACT CTTTATGATT TGTTTTAGCT GTATTGCAAT TTTCAACTGT ATTATATGTT TCAAAGTCTT  ATGGAGTAAA TTGATATATC AAACACACAT ACATGTCTTG TGTCTTCATT AAATTCTGAA AAGTTAAATA CATAGTAGAT TGTAAGACTA TTTGTGGATG GATATATATA TATATATATA  TATATATATA TTTTCTTAAA GATCATAATG TCAAAGTTTC CTAAAATTTC AGTTGTATGA ACGGTAACTT ACTATTTTTC CTCCACACAA GGGTCCAAGG AGACATGTGC AAGTAATAAA  TGCAACACAC ATAGGAAGAC ACACGGCTAC CATCTTCCAC CATGGCAACA ATGCGATATT TGGCAAGATT TGACGGACTC CATACATTAC TCTACTACCA AATCAAAAGT ATTGGTCTCA  AGTACACCTA AATCACTTTG CAATTAGCCA GACCACTGTT TCACAACTAA ACACGTCTTC ACCCAAAAAA TCGGTCTACA AACTTGGGAC AGGTAAACTT TAGTAAAACA TTCATGAAAA  TAGTGAGTAT ACTTGGATCC ATATCTCAGG TCTAATCCAA ACACTCTTTG TGAGTCTATG ACAAGGGTAT ATATAACCTC ATTTTGGAGT CCCTAATAGC ATAATCTCCT TCCAGATTGA  TTCATCCACC TCTTTTTAGA CGTGATGATT TACTCCGTGT TATCGTATTA TCAATCATTT AGATTACTAC TACCAAAGAG GGCTCGAGAA ATAATATCGT ATAGTTGCAA CTTTGTTGCA  TGATAAGCTT TGACTAGTCT TCATCAAATC CATAGCTTTT GCACCGCTCA GCTTTTCCGT ACAGCATTTT TGTCAAATGC CATTTTTACT TCTTTTCAAA ATTAGTGAAT ATAATATGGA  AAACGTGTTC TCCCTGTGAC CTATGGACCT TTTATGGGTG TAATATTTGT GGATATGGAA TTTAAAATTT CTTAATGAAG CTGCTATTTA GCGTTAATTT TTAAGTAGCT CTCCCTTTTC 
CTTAGAACGT GTAACACTTT TGTATATGTA GATAATAGTA GAACGAAAAA AAACTCTTTG TAGAGAGATT CTGCTTCTAT 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTAGTGTT GGCATATGTG GTACACAAAT TTCCAGGTTA TTGTTGGTAT ACCAGAATTC TTTCTGTAAC GTAAATAAAA TTATACAATC GCATGATTTG TTCAATAACC ATTCCATATA  AACATCAAGC AGTGCCTTTA GGCTTATTCA TAAACATCCA ATTATTAGAA TATTTACAAC ACACACAAAC ATATTCAATT CGTGGATAAA TTTAAAATGA GAGTGCTTAA TTATAAGACT  AACGTTGGCG TCGAGAAGAA GAAGACTGTT TCCTTGACTG TGGGAGAAAT CTATGGCGGA GATAAATCGG TCTAGATACT TGTGATGATC TACGAGATAC TCGAGGAGGA GGATCTCGTA  TCTTTCGAGT CTTAATAAGA GGTGTCCGTG GCTCTTCACA AACTTCTCCG AGAAGAAGAT CTTCGGGGTC GAGGAAAACT GAGTATACGG GCCAGTCGAA GGAATTTTCG ATCGGTTCAA  AGACCGGCCA GACGAAGGAA TTAAAGGCAG TTGCGAGCTC CCGTCTCCTG TTAAGCAAAT CTTCGTCAAA ATCCAATATC AGGCGTCGAT AACTCACTGC TGTGTCGATG GTCGATGTCT  CTATGAGTTT GTATTTCTCT AACCTGCAGG CAAGACTCTC GCTCGTCTCC TCCATGTCTT CTTTCAGATA TCAATCTGCA AAAGTTCTTT GTAAGACTTT ATATACACTA TTAAGGTCTT  TATTATTGTT TTAAAGAATA AATTATTGTA TTTTACCTTC ATAATTGTCA CCATTATCTC AAGATTTAAA AATTACAAAG ACTCGTCAAT GAAATTACTC GGAACAAGTT AAGCTAATTT  TTTTGTTAAA ATGTGTTGGC AAACCAAAAA CTAGAACTTT CACAGAACAG CGCAACATTA CACCCGAATT CAAAGGATTA TTATAGACAA CTTGCGATTT TTTCCCCCTA ATTTGCTAGT 
ATTAAACAAG TGCAACCACT ATAATATGTC CCTAATGATA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCTCTTACGCATCATTCTCTACACCCTTCAATGGTTTCGCTGCAAATCCGTCTCCGATTACTTCCGCTTTTCTCGGCCCATCATTGAGATTCTCCACCAGAACATCAAAAACT
CGGAATCCGAGTAATGGGGTTTCAGTGAAATCGTCAAATAGTCATAGGTTTCTAGTCAAATCTAAAAATTTCAGTGTCTATGCAAGGGCTGCAGCAGAGAAGTCTGTTCACGATTTCACT
GTAAAG
GTATGTTTCTTTTAATTTATCTGAAGAAGAAAATTAGGTTTTTGTTTCTTCGTTATCGAAATTGAAGAATTTGTTCTGTCGTCAAAATATGATTTTTCTCAACCTCACTGAATT
ATGTAGTACATGTGAGAGCTTCCTAATTAAAACCTAGACTTTGGAGACATAATTGTGTTTTTTTGAAACAGGACATCGATGGTAATGATGTTTCTCTGGACAAATTCAAAGGAAAACCTT
TGTTGATCGTTAACGTTGCGTCAAGATG
GTGATTGTTTTTATTGTTTCTTCGAATTCTTTCTATTTGATAAGTTTTTGCATCTGAATTTTTTTTTAAGTTTATTTTTTAACTTCACGGTG
TCAGTGGTTTGACATCATCAAATTACTCAGAGCTTTCTCAACTGTACGAAAAATACAAGAACCAAGGTGTGCTTGTTATAGTAAGCTTTTTACACATCTAAATTTAATTAAGGTAACACA
GTGATTGTGAGATTCTTATTTATTGTGTCTCTCTCGTTTTTAGGATTTGAGATTCTTGCTTTCCCTTGCAATCAATTTGGAGGTCAAGAACCCGGTTCAAACCCTGAGATCAAGCAATTT
GCTTGCACCCGGTTCAAAGCAGAGTTCCCTATATTCGACAAG
GTATATAGAAAAAAAGAACTCTCGTTTTTTTGAGTTTAGGGAGATATCTTTTAATTAGTTTTGATAAGTTATGTTCTT
CAGGTTGATGTGAATGGACCAAGCACAGCTCCAATCTACAAGTTCTTGAAATCCAATGCTGGTGGTTTCCTTGGTGATATCATCAAATGGAACTTTGAGAAATTCTTGGTTGATAAAAAG
GGCAAAGTTGTCGAGAGATACCCTCCCACAACTTCTCCTTTCCAAATCGAG
GTACCAAATTCAAAACTCTAATTCAATCTGGATAACTGGATCCATGGTTCATGTCGTGAACCAAACCAC
CAGTTGAACTTTTCTAATGTAAATAGAGAATCTATCAATTTTACGTTTTAACATTCCTAACATATGTAAAATATGGATTTAAATTTGATACCAAATAAGTTTACTAACATTATTTTTCCA
TGTGACACGGCGGAATGTTGAGTGGTCCTATAATTTAATACTAACAATATGTTTGTTTGGCAGAAGGACATCCAGAAGTTGCTTGCGGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCTCTTACGCATCATTCTCTACACCCTTCAATGGTTTCGCTGCAAATCCGTCTCCGATTACTTCCGCTTTTCTCGGCCCATCATTGAGATTCTCCACCAGAACATCAAAAACT
CGGAATCCGAGTAATGGGGTTTCAGTGAAATCGTCAAATAGTCATAGGTTTCTAGTCAAATCTAAAAATTTCAGTGTCTATGCAAGGGCTGCAGCAGAGAAGTCTGTTCACGATTTCACT
GTAAAG
GACATCGATGGTAATGATGTTTCTCTGGACAAATTCAAAGGAAAACCTTTGTTGATCGTTAACGTTGCGTCAAGATGTGGTTTGACATCATCAAATTACTCAGAGCTTTCTCAA
CTGTACGAAAAATACAAGAACCAAG
GATTTGAGATTCTTGCTTTCCCTTGCAATCAATTTGGAGGTCAAGAACCCGGTTCAAACCCTGAGATCAAGCAATTTGCTTGCACCCGGTTCAAA
GCAGAGTTCCCTATATTCGACAAG
GTTGATGTGAATGGACCAAGCACAGCTCCAATCTACAAGTTCTTGAAATCCAATGCTGGTGGTTTCCTTGGTGATATCATCAAATGGAACTTTGAG
AAATTCTTGGTTGATAAAAAGGGCAAAGTTGTCGAGAGATACCCTCCCACAACTTCTCCTTTCCAAATCGAG
AAGGACATCCAGAAGTTGCTTGCGGCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCT CTTACGCATC ATTCTCTACA CCCTTCAATG GTTTCGCTGC AAATCCGTCT CCGATTACTT CCGCTTTTCT CGGCCCATCA TTGAGATTCT CCACCAGAAC ATCAAAAACT  CGGAATCCGA GTAATGGGGT TTCAGTGAAA TCGTCAAATA GTCATAGGTT TCTAGTCAAA TCTAAAAATT TCAGTGTCTA TGCAAGGGCT GCAGCAGAGA AGTCTGTTCA CGATTTCACT  GTAAAGGACA TCGATGGTAA TGATGTTTCT CTGGACAAAT TCAAAGGAAA ACCTTTGTTG ATCGTTAACG TTGCGTCAAG ATGTGGTTTG ACATCATCAA ATTACTCAGA GCTTTCTCAA  CTGTACGAAA AATACAAGAA CCAAGGATTT GAGATTCTTG CTTTCCCTTG CAATCAATTT GGAGGTCAAG AACCCGGTTC AAACCCTGAG ATCAAGCAAT TTGCTTGCAC CCGGTTCAAA  GCAGAGTTCC CTATATTCGA CAAGGTTGAT GTGAATGGAC CAAGCACAGC TCCAATCTAC AAGTTCTTGA AATCCAATGC TGGTGGTTTC CTTGGTGATA TCATCAAATG GAACTTTGAG 
AAATTCTTGG TTGATAAAAA GGGCAAAGTT GTCGAGAGAT ACCCTCCCAC AACTTCTCCT TTCCAAATCG AGAAGGACAT CCAGAAGTTG CTTGCGGCTT AA 

Retrieve as FASTA