Entry information : PpePrx06 (ppa008349m)
Entry ID 2259
Creation 2005-09-26 (Christophe Dunand)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx06 (ppa008349m)
Name (synonym) PpePrx06 (ppa008349m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type Fruits
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx06
start..stop
S start..stop
RcPrx17 580 0 1..331 1..331
CpapPrx44 578 0 1..331 1..331
CclPrx35 577 0 1..330 1..330
CsPrx10 575 0 1..330 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17167174..17167398 225 N° 2 17167552..17167743 192 N° 3 17167840..17168005 166 N° 4 17168133..17168560 428
join(17167174..17167398,17167552..17167743,17167840..17168005,17168133..17168560 )


exon

Literature and cross-references PpePrx06 (ppa008349m)
Literature Le Dantec,L., Cosson,P., Renaud,C., Garcia,V., Dumoulin,P., Rothan ,C., Filippi,G., Laigret,F., Moing,A. and Dirlewanger,E. Peach (Prunus persica (L.) Batsch) fruit ESTs from two early development stages.
DNA ref. Phytozome 12:   scaffold_7 (17167174..17168560)
EST ref. GenBank:   AJ876156.1 [5' end]
Protein sequence: PpePrx06 (ppa008349m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (314)
PWM (Da):   %s   36985.99 (34651.7)  
PI (pH):   %s   9.29 (9.57) Peptide Signal:   %s   cut: 23 range:23-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQSLSFLLALSLLALVPLCFCDKTLGGYLYPQFYDHSCPRATEIVKSVVAKAVAREARMAASLLRLHFHDCFVQGCDASILLDSSKNIITEKRSVPNQNSARGFEVIDEIKSALEKECPNRVSCADILALAARDSTVLSGGPNWEVPLGRRDSKGASLSGSNNNIPAPNNTFQTVLTKFKRQKLNIVDLVALSGSHTIGNARCTSFRQRLYNQSGNGLADFTLDQSYAAQLRTRCPRSGGDQTLFFLDFVSPTKFDNSYFKNLLASKGLLNSDEILITKSEVTKQLVQQYAENTELFFEQFAKSMVKMGNISPLTGSRGEIRKRCRKINSINQNA

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. Cultivar "Fantasia".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAGTCTTTGAGCTTCCTTCTAGCTCTTTCTCTTCTTGCCCTTGTCCCACTTTGTTTCTGTGATAAAACTCTTGGTGGGTATCTCTACCCACAGTTTTATGACCACTCCTGCCCT
AGAGCAACAGAGATTGTAAAGTCTGTTGTTGCCAAGGCTGTTGCAAGAGAAGCTCGCATGGCTGCCTCTTTGCTTAGGCTGCATTTCCATGACTGCTTTGTACAG
GTATCGGATTACAAA
AATCAGCCGATTTGCTTCTAGTTAAATATTGTATCAAATCATTCTAATGCATCTCATTTGATAAATAAAAAAAGAAGTTATGTTAACACCTTATGACTGAGGTACTTAAAATCATGTTGG
TAATTTTGAATGTTGCAGGGTTGTGATGCATCAATTCTGTTGGACAGCAGCAAGAACATAATCACGGAGAAGAGGTCTGTCCCAAACCAGAATTCAGCTCGAGGGTTCGAAGTAATCGAT
GAAATCAAGTCTGCATTAGAGAAAGAGTGCCCCAACAGAGTGTCCTGTGCTGACATTTTGGCTCTTGCTGCTAGAGACTCCACTGTGCTA
GTAAGTGTTACATTTTTAGCTTTGTAAATT
GCATGGTGTAAGAACCTAAGCCTAAATTCACATATGCTGACTATAAATTGTTGCTGCATATTGCAGTCTGGGGGGCCAAACTGGGAGGTTCCACTAGGCAGAAGAGATTCAAAAGGAGCA
AGTTTAAGTGGCTCCAACAACAACATCCCTGCTCCAAACAACACTTTCCAAACTGTTCTCACCAAGTTCAAGAGGCAAAAGCTCAACATTGTTGATCTTGTGGCACTATCTG
GTAACATT
GCCAAAAAAACACAACATAGTTCTTCATTATTTACTAAAAATAAAAATTACCAAAAAAGCTAACATGCCCTGAGCTTTGTGTTTCTCGATCAGTTTTTTTTATTTCCATTGATATGCAGG
AAGCCACACCATTGGAAATGCCAGATGCACCTCATTCAGGCAGAGGCTTTACAACCAGTCAGGCAATGGCTTAGCTGACTTCACCCTTGACCAATCATATGCTGCACAGTTGAGAACCAG
GTGCCCAAGATCTGGTGGAGACCAAACCCTGTTTTTCTTGGACTTTGTCAGCCCAACGAAGTTTGACAACAGCTACTTCAAGAACTTGTTGGCTTCCAAGGGCCTCCTGAACTCAGATGA
AATTCTTATCACGAAGAGTGAAGTGACAAAGCAATTGGTTCAACAGTATGCTGAGAACACTGAGCTTTTCTTTGAGCAGTTTGCCAAGTCCATGGTGAAGATGGGAAATATTTCCCCACT
TACAGGGTCAAGGGGAGAGATCAGAAAGAGATGCAGGAAGATCAACTCAATCAATCAGAATGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAGTCTTTGAGCTTCCTTCTAGCTCTTTCTCTTCTTGCCCTTGTCCCACTTTGTTTCTGTGATAAAACTCTTGGTGGGTATCTCTACCCACAGTTTTATGACCACTCCTGCCCT
AGAGCAACAGAGATTGTAAAGTCTGTTGTTGCCAAGGCTGTTGCAAGAGAAGCTCGCATGGCTGCCTCTTTGCTTAGGCTGCATTTCCATGACTGCTTTGTACAG
GGTTGTGATGCATCA
ATTCTGTTGGACAGCAGCAAGAACATAATCACGGAGAAGAGGTCTGTCCCAAACCAGAATTCAGCTCGAGGGTTCGAAGTAATCGATGAAATCAAGTCTGCATTAGAGAAAGAGTGCCCC
AACAGAGTGTCCTGTGCTGACATTTTGGCTCTTGCTGCTAGAGACTCCACTGTGCTA
TCTGGGGGGCCAAACTGGGAGGTTCCACTAGGCAGAAGAGATTCAAAAGGAGCAAGTTTAAGT
GGCTCCAACAACAACATCCCTGCTCCAAACAACACTTTCCAAACTGTTCTCACCAAGTTCAAGAGGCAAAAGCTCAACATTGTTGATCTTGTGGCACTATCTG
GAAGCCACACCATTGGA
AATGCCAGATGCACCTCATTCAGGCAGAGGCTTTACAACCAGTCAGGCAATGGCTTAGCTGACTTCACCCTTGACCAATCATATGCTGCACAGTTGAGAACCAGGTGCCCAAGATCTGGT
GGAGACCAAACCCTGTTTTTCTTGGACTTTGTCAGCCCAACGAAGTTTGACAACAGCTACTTCAAGAACTTGTTGGCTTCCAAGGGCCTCCTGAACTCAGATGAAATTCTTATCACGAAG
AGTGAAGTGACAAAGCAATTGGTTCAACAGTATGCTGAGAACACTGAGCTTTTCTTTGAGCAGTTTGCCAAGTCCATGGTGAAGATGGGAAATATTTCCCCACTTACAGGGTCAAGGGGA
GAGATCAGAAAGAGATGCAGGAAGATCAACTCAATCAATCAGAATGCATGA

Retrieve as FASTA