Entry information : PpePrx13 (ppa008504m)
Entry ID 2263
Creation 2005-09-26 (Christophe Dunand)
Last sequence changes 2011-06-29 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx13 (ppa008504m)
Name (synonym) PpePrx13 (ppa008504m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type Fruits
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx13
start..stop
S start..stop
CclPrx59 493 1e-177 10..324 16..329
EgrPrx124 493 2e-177 4..324 6..325
NtPrx31-1A 493 2e-177 9..324 12..327
CsPrx09 488 7e-176 14..324 1..310
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15823757..15823963 207 N° 2 15823219..15823410 192 N° 3 15822932..15823097 166 N° 4 15822226..15822650 425
complement(join(15822226..15822650,15822932..15823097,15823219..15823410,1582375 7..15823963))


exon

Literature and cross-references PpePrx13 (ppa008504m)
Literature Le Dantec,L., Cosson,P., Renaud,C., Garcia,V., Dumoulin,P., Rothan ,C., Filippi,G., Laigret,F., Moing,A. and Dirlewanger,E. Peach (Prunus persica (L.) Batsch) fruit ESTs from two early development stages. Unpublished (2004).
DNA ref. Phytozome 12:   scaffold_7 (15823963..15822226)
EST ref. GenBank:   AJ873648.1 [3' end]
Protein sequence: PpePrx13 (ppa008504m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (307)
PWM (Da):   %s   36005.09 (33340.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.86 (6.74) Peptide Signal:   %s   cut: 23 range:23-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHKFWVVTLFCLLFLSPLVSCQLNYRFYDATCPNLTRIVQSGVWSAIANDSRIAASLLRLHFHDCFVNGCDASLLLDDTGSLIGEKNAPGNKNSVRGFEVIDTIKSNVEEACPSTVSCTDIITLVSRAAVYFSGGPYWPVPLGRRDSTTASENAVREQLPSPFEPLENITAKFTAKGLDIKDLVVLSGAHTIGFAQCFTFKTRLFNFGESGKPDPTLDASLLQNLQSLCPNQADSDTQLAPLDPVTSTKFDNIYFKNLVNNSGLLQSDQVLMGNNRTASMVFGYSKLPFLFYRDFGASMVNMANIGVLTGSNGEIRKNCRAVNKKTTA*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCATAAATTCTGGGTTGTTACCTTGTTTTGCCTCTTGTTCCTCAGCCCTCTTGTGTCCTGTCAGCTTAATTATAGATTCTATGATGCCACTTGTCCCAACCTGACCAGGATTGTT
CAATCTGGCGTTTGGTCAGCTATTGCAAATGATTCTAGAATTGCAGCCTCACTTTTGAGGCTTCACTTCCATGATTGCTTTGTTAAT
GTAATTAACTTGTCTTCACTCATTTCTTATATA
TTTACTACATCTAAATACTTGTGTTTGCCTAACTATAATCATTAACAAAATATCCGAACCCTATTTCTTGTATACAATTTAATAAAAGTTAAAGCTATTATAATTCGAGGACCTTGTACA
TAATTTTTGACTGTTTTATGAAGATGTTTAGTTGGTTAAGGTAATATGCATGCTCCTTGTAGCCGAGTTTGAATCTCCCTCCACAAAATTTAGATTAATTTAGAATATCGCTTTGTTAAA
AAGAACGAGACAGTTTGCTAATTTGATTAGCTCTGGTTTATTGACGACTTGGTTTGATTTTGTGGGGAGGTAGGGATGTGATGCATCTTTGTTGCTTGATGATACCGGCAGTCTTATTGG
GGAGAAAAATGCACCGGGCAACAAAAATTCAGTCAGAGGTTTTGAGGTGATTGACACAATCAAGTCAAATGTGGAGGAAGCTTGCCCATCCACTGTTTCTTGTACTGACATAATCACTCT
TGTGTCAAGAGCAGCTGTTTATTTT
GTAAGAAGTTAGCTCCTTTATTTACTATGCAGAGGTTTATGAAATGAATCATTTAATTAATCTCTGAAATAACCCCAAATAATTTAAATTTCTAC
ATCATTTATCTTGTTTTTTTGGTCAGAGTGGAGGGCCATATTGGCCTGTACCCTTGGGTCGTCGAGATAGCACAACAGCAAGTGAAAATGCAGTTAGGGAACAGTTGCCATCACCCTTTG
AGCCCTTGGAGAACATCACTGCAAAATTTACAGCAAAAGGCCTTGACATAAAGGATTTGGTTGTGCTCTCAG
GTTTGCTTCCTATCTCATATCAACTTCTCACGTTTGAAAACTTGTCAC
ACCCTTATTTGTAACAGATTAGAAATTTAACGGGTTCACGATGACACATTTAAAACGAGAATTCTTATCCAATGATAGCACTTATTCATATTTTCCTAAAAGGGTTTTCAGATTTGTTAT
GAATCCATCACACTAAACAAAATAAAATTTTGGCTGATTATTACTAAAAGCTCGGATAATTACAAAGGTTAATGAGCCAGCCTTATATATGTGGACTTTGTGTCTTTATGCAGGTGCACA
TACCATCGGCTTTGCTCAATGCTTCACTTTCAAGACAAGACTCTTCAACTTTGGTGAGTCTGGCAAGCCTGACCCAACATTAGACGCATCACTTTTACAAAATCTGCAAAGTTTGTGCCC
AAATCAAGCAGACTCTGACACTCAATTGGCTCCTCTGGATCCTGTCACTTCAACCAAGTTTGACAATATATACTTCAAGAACCTTGTGAACAATTCTGGACTTCTACAGTCAGATCAAGT
GCTTATGGGGAACAATAGAACTGCTTCAATGGTTTTTGGCTACAGCAAATTACCTTTTCTGTTTTACAGGGACTTTGGGGCATCAATGGTGAATATGGCCAATATTGGTGTGCTCACAGG
AAGCAATGGAGAAATCAGGAAAAACTGTAGGGCGGTGAATAAAAAAACTACTGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCATAAATTCTGGGTTGTTACCTTGTTTTGCCTCTTGTTCCTCAGCCCTCTTGTGTCCTGTCAGCTTAATTATAGATTCTATGATGCCACTTGTCCCAACCTGACCAGGATTGTT
CAATCTGGCGTTTGGTCAGCTATTGCAAATGATTCTAGAATTGCAGCCTCACTTTTGAGGCTTCACTTCCATGATTGCTTTGTTAAT
GGATGTGATGCATCTTTGTTGCTTGATGATACC
GGCAGTCTTATTGGGGAGAAAAATGCACCGGGCAACAAAAATTCAGTCAGAGGTTTTGAGGTGATTGACACAATCAAGTCAAATGTGGAGGAAGCTTGCCCATCCACTGTTTCTTGTACT
GACATAATCACTCTTGTGTCAAGAGCAGCTGTTTATTTT
AGTGGAGGGCCATATTGGCCTGTACCCTTGGGTCGTCGAGATAGCACAACAGCAAGTGAAAATGCAGTTAGGGAACAGTTG
CCATCACCCTTTGAGCCCTTGGAGAACATCACTGCAAAATTTACAGCAAAAGGCCTTGACATAAAGGATTTGGTTGTGCTCTCAG
GTGCACATACCATCGGCTTTGCTCAATGCTTCACT
TTCAAGACAAGACTCTTCAACTTTGGTGAGTCTGGCAAGCCTGACCCAACATTAGACGCATCACTTTTACAAAATCTGCAAAGTTTGTGCCCAAATCAAGCAGACTCTGACACTCAATTG
GCTCCTCTGGATCCTGTCACTTCAACCAAGTTTGACAATATATACTTCAAGAACCTTGTGAACAATTCTGGACTTCTACAGTCAGATCAAGTGCTTATGGGGAACAATAGAACTGCTTCA
ATGGTTTTTGGCTACAGCAAATTACCTTTTCTGTTTTACAGGGACTTTGGGGCATCAATGGTGAATATGGCCAATATTGGTGTGCTCACAGGAAGCAATGGAGAAATCAGGAAAAACTGT
AGGGCGGTGAATAAAAAAACTACTGCCTAG

Retrieve as FASTA