Entry information : AtPrx61 (At5g24070 / PER61 / AtperoxP61)
Entry ID 227
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: AtPrx61 (At5g24070 / PER61 / AtperoxP61)
Name (synonym) AtPrx61 (At5g24070 / PER61 / AtperoxP61)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx61
start..stop
S start..stop
AlyPrx61 685 0 2..340 3..341
BstrPrx68 672 0 1..340 2..341
TsPrx61 651 0 2..340 3..341
CrubPrx58 641 0 1..340 1..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8135746..8135991 246 N° 2 8135486..8135665 180 N° 3 8135219..8135378 160 N° 4 8134301..8134737 437
complement(join(8134301..8134737,8135219..8135378,8135486..8135665,8135746..8135 991))


exon

Literature and cross-references AtPrx61 (At5g24070 / PER61 / AtperoxP61)
Protein ref. UniProtKB:   Q9FLV5
DNA ref. Phytozome 12:   Chr5 (8135991..8134301)
mRNA ref. GenBank:   NM_122312
Cluster/Prediction ref. Phytozome Gene 12:   19671237 UniGene:   At.54966
Omic ref. AtProteome:   At5g24070 ATTED-II:   At5g24070 e-FP Browser:   At5g24070 ePlant:   At5g24070 Genevestigator:   At5g24070 RnR:   At5g24070 TAIR:   At5g24070
Protein sequence: AtPrx61 (At5g24070 / PER61 / AtperoxP61)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (315)
PWM (Da):   %s   37217.67 (34558.2)  
PI (pH):   %s   7.36 (7.36) Peptide Signal:   %s   cut: 26 range:26-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQFVNFFPLLALVVISLAGKATVEAATGLNPPVKLVWHYYKLTNTCDDAETYIRYQVEKFYKNDSSIAPKLLRLLYSDCMVNGCDGSILLQGPNSERTAPQNRGLGGFVIIDKIKQVLESRCPGVVSCADILNLATRDAVHMAGAPSYPVFTGRRDGGTLNADAVDLPSPSISVDESLAYFKSKGLDVLDMTTLLGAHSMGKTHCSYVVDRLYNFKNTGKPDPTMNTTLVSQLRYLCPPRTQKGQTDPLVYLNPDSGSSNRFTSSYYSRVLSHNAVLRVDQELLNNDDSKEITQEFASGFEDFRKSFALAMSRMGSINVLTGTAGEIRRDCRVTNANDGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns). No EST. Containing motif 'YSDC'.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAATTTTTG TTTTCTTTAA ACTAGGGTTT TCGAGGACTA ACTATGTAGG ATAAGTATAG TTCATGAACA ACTCACTCAC TAGATTTCTA AATAGATCTG ATGTGATATC ATTTCGAGTG  AAAAAGTGAA ATTTTTCTAA TGGATATTAA ATCTAAAGGA AGCGAATTTC CATAATGTTA CGTAATTTTT ATGACTAGGT CAATACTACG AGTAATTTGT TTTCTAAACT TTTACCTTTT  TAATACATAT TTTATGACAA ATGGACGTAA TTAACTAACT AATACGGTGA GCGAAAGAAA AGGCAGCTGA CGAAATTGAA AAGAAAGAAA ACGAGTGAGA GATTGATTTA TTTAATGCAC  AAGTTTAGTA GGTGATCTTT TAATATTTTA ACGCATGTTG ATATGAAAGT TGGAAAAAAT AAACCATGTT GGCATGGAAA ATTCAATAAA AGTAACATAG TTGTATTACA AAGTGACAGT  TTACAGAAAT TCCTGTGAAA TGAAATACCA AGTTTTTTCC GATTAATTGA CGCTTAAGAA AGGACAAGTT TTCAGCAATG CGTTGGCGTA GTATTGTTAT TCATTCCTTA ATTACTCTTA  CAGCTAGATT TTGGTATAAG GTTTTTGTTT TCTCGTATAG TGAATTAGCT TACTTATTTA TACATCCATA ACAAGAGCAA GCGAAATGTT TAATTATGAA TATTTATCGC CGACCAGTTT  GGCTCACAAA ACGTTGATTG CAAATTTTAA AACATAAGTA TAAATAAGAA AACTAATTTC AAAACTTAAG TATAAAAAAC AGTTAAAACT AAAGTAATAT AATTTGATTT GAAATTTCTT  GATTTAGTTA GCATGATCTA TTTTGAATTT TTTTTGAGTG GAATTGTAGA CTATGCAAAG AGAGACAACT TTTATATGTA TATGGAGATA CACACTGTTA TTGAGATAAA CTTTTTTTGG  GGTATGGAAT ACACACTGTT ATAATAGTAA GCTTTATTTA TTTATCTCTA CAACTAAAAT TAAATATTAT TAGGTACAGG AGGAAAAGTG AAACTACAAT GTAAAGGAAT TCGAGTCAAA  CGGGTAAAGA AATAACCAAC TAGGTCATAC AAAATAGCAA AAACCACTAG GGCATATATA CTTTAAATTC CTCAATATGT GTTCTACAAT TTACATCAAA ATTTGAATAG GGGTGACAAC  TACCCTCCCT AGTCACTACC TAAGTCCCCA AATGACTGCA ACATTTATTA TTATTTCAAA ACTACCACAT ATTACAATGA GTCAAATATT TAAGATAGAG AACTTTTTTT TACTAATTTC  TTTTTAATTT AATTAACTAT TAACTAATAA GATATATATA TTTGGTTAAA TAACACATAA TCTTAGCTAA ATATATATGC TTTTGAATGT ATTGATGAAC TTCATATGTC ATTTTACTAT  AATAACATCT AATTGTAAAT GAAGAATATA AAAATATTAA TGGGACTCAC TTTCTAAAGT GTGATAACTT GAAATCTCTA CAAACATATA TAGTATTTTT GAAATTTAAG GAGGTATTTC  ATTACAATAT TTTAAGTGTG AACTATTTGT GGTATACCAA TTACCAAGCA ACCCACATAA TTAACACTAA TAATCATAAA TCCATAATTT GGAACGTGGA AGAACATCGT TTCATGTGAA  TCCGCGTTTG TCCTACACGC GCTTCCTTGT ACTGTACATC AAACCGATCA AAGTCAGAAC GTAATAATAG TTTTTTATAT CGACATTACC GGTTCACTCA CGTGGACTTG CCATGCAAGT  CAAACCTTAT ATATAACTCT CATTATCGAG TACTAATCCA TATCTTAATT CATTACATTC ATTTTTCCCT CTATCTTTTC TTTTATCTTA AACACAAATA ATAAGAATCT AAGATACTTT 
GATCTTTTAA TCAAGAAAAT AAACACAAAC TCCTAGGGTT TTTTGTGGTG GAAGATTTTT TCGTTTTTAT ACTAAAAATA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACTATATTAT AAATTTTATA TTATGTTTGT CCAAAAAAAA AAAAATTTAT ATTATGTAAT TTTTGTGTGT GTGTGTTTAT AATATAAGTA TAAATTATTT TGATAACAAA ATATTATCAA  TAAGACTCGG AAATAAAGAA GAGAAATTGC ATTCTATGAC AAATTGACAA AACATTAAAA ATTTATAAAG CAACACAATT TACACAAAGA CTATTTGAAA TGCATTATCA TATGTGTAAA  AAACAACAAC ACTCTTAATA AAATGTGACC AAATTAACCA ACCAACAAAA CTACTTGTTA CAAATAACAT TTTATTGTTA CATCGAAACA TATAAATATT GACTAATCTG GCTAACATTG  AAATTGGTAA AATGAAATGG TTGAATAATT GAAAAATGAG ATTATTCAGG AATACACATT GAATGCAAAG ATTACGCATT TCATTTCTGG TAGTAGATCT ATAATCAAAA AAGTGTTTGT  GATTGTTTCA AAAGAAATGA AATAAAAGAT ACGGTAGAGC TAGAAGAGTT ATTGTATGAG GTTTACCCAA TACTAAAAGC AGAAGCGCAT AATAGATTGA TATGAACATC ATAAGCTGTC  CCGCAATAAA ACATGTTGTT GCGATACTTT CTTCCCGGTC TTTGTTTTCC TTCGTCCAAA CTCGGAGAAG AAAGAGATAA GAGGGTCCTA TAGAAAATAT GGTCAGAAAT TCATAATAAA  GTCCGACCAC AATGACCGAA TTTATTATCT TCATGTATAA GGATACTAGA TTACCTAGTA TAAAAGATTG AAAAACCATC ACAAACCTCC CTTTTTTCTT TTCTATTTCA ATTTTTGGAT  TATGATATGA TGATTTTGCA ACGTCAGAAG TGTTGGTTAC TTTGACAAAA ACGCATCGTT TCAAAGATTT TTTTGGCGTA GCCGGAAAGA ACACGTCATC ACCATTAAGC AAAATCCCAA 
AGAGATAGTA TTTGCTACTT CGGCTTCGCC TTGAGGGTCT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTTTGTGAATTTTTTCCCACTATTGGCCCTCGTAGTCATAAGCTTAGCCGGAAAGGCTACGGTAGAGGCTGCGACGGGATTGAACCCTCCGGTGAAGCTTGTCTGGCATTATTAC
AAACTTACTAACACTTGTGATGATGCAGAGACTTATATTAGATACCAAGTTGAAAAGTTTTATAAGAATGATAGTAGCATTGCCCCAAAGCTGCTTCGTCTCCTCTACTCCGATTGTATG
GTTAAT
GTAAGTAAAAGCAACTAGAACATCAACATTACATTCATTTCTTTTTCATAGCCATTGATCGATGTAAAATGTGTATGTAGGGATGTGATGGTTCGATTCTTTTGCAAGGACCAA
ACTCAGAGAGGACAGCTCCACAGAATCGAGGGCTTGGAGGTTTTGTGATAATCGATAAAATAAAGCAAGTTCTTGAATCACGTTGTCCTGGTGTCGTTTCTTGCGCTGATATCCTCAACC
TTGCCACTAGAGATGCTGTTCACATG
GTAAACATATTCATATACTTGAATGTTCTTACTAACGTAGATTTATCGATTTATTTGAACTTTATTGTTTGGTGTTGTTTTGATAAATTCGGTG
TAATAATGATTAGGCCGGAGCACCGTCTTATCCTGTGTTTACGGGGAGAAGGGACGGTGGGACATTAAATGCAGACGCCGTAGATCTGCCGTCACCGTCCATCTCAGTCGATGAGTCATT
GGCATATTTCAAGTCCAAAGGTCTTGACGTTTTGGATATGACTACTCTTCTAG
GTATCTCATCATCGTCAATTTTTTTTTCTATTTATTTTTTCCTTTAGAAACAAGCATCTTTCAATCC
ACAACCATACGTATTTAAATCAAAATAAGTTTGTAATTATAAGAGTATACACCAAATGAATTGTTGCGTTGCTTTTTGGCCGTTGCGTTTGAACTCTGCAAAAGTATTTTATAAAAATCT
GAAAATGTTAAAATATTAATAAATAAAAACAACTGAGATTGTAGTTCAATTGTCTACCTATGTTTAGTTACTGTAAACACATTTAACTACTTTAAGGATTACAAATATTTGAATTAATTC
TCATCGTATGCAATACTTTAAATAATATAAAATTTACAAGATAGTTTCACATCCTAGAAGAATATCCAAAAAATAGACTAGTAATCCAGAAAGGAAAATATAATCTACAAGCAAAGTGGA
GCTAAATAGTCTTGGGTGAATATAACAACCTCTAATAATTGTGTAATTGAACAGGAGCACACTCAATGGGGAAGACACATTGTAGCTACGTAGTGGACAGACTATACAACTTCAAGAACA
CAGGGAAACCAGATCCGACCATGAACACGACATTGGTGTCACAACTTCGATATCTTTGTCCTCCAAGAACACAAAAGGGCCAAACCGATCCACTGGTTTACCTAAATCCAGACTCAGGCT
CGAGCAACAGATTCACAAGCTCATACTACTCTCGTGTCTTGTCTCATAACGCTGTTTTACGGGTGGACCAAGAGTTGCTCAACAACGATGACTCGAAGGAGATCACGCAAGAGTTTGCTT
CCGGTTTTGAAGATTTCAGAAAGTCTTTTGCTTTGGCAATGTCGAGAATGGGATCTATCAATGTTTTGACGGGAACAGCTGGAGAGATTCGTCGAGACTGCAGAGTTACCAACGCTAATG
ACGGGGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTTTGTGAATTTTTTCCCACTATTGGCCCTCGTAGTCATAAGCTTAGCCGGAAAGGCTACGGTAGAGGCTGCGACGGGATTGAACCCTCCGGTGAAGCTTGTCTGGCATTATTAC
AAACTTACTAACACTTGTGATGATGCAGAGACTTATATTAGATACCAAGTTGAAAAGTTTTATAAGAATGATAGTAGCATTGCCCCAAAGCTGCTTCGTCTCCTCTACTCCGATTGTATG
GTTAAT
GGATGTGATGGTTCGATTCTTTTGCAAGGACCAAACTCAGAGAGGACAGCTCCACAGAATCGAGGGCTTGGAGGTTTTGTGATAATCGATAAAATAAAGCAAGTTCTTGAATCA
CGTTGTCCTGGTGTCGTTTCTTGCGCTGATATCCTCAACCTTGCCACTAGAGATGCTGTTCACATG
GCCGGAGCACCGTCTTATCCTGTGTTTACGGGGAGAAGGGACGGTGGGACATTA
AATGCAGACGCCGTAGATCTGCCGTCACCGTCCATCTCAGTCGATGAGTCATTGGCATATTTCAAGTCCAAAGGTCTTGACGTTTTGGATATGACTACTCTTCTAG
GAGCACACTCAATG
GGGAAGACACATTGTAGCTACGTAGTGGACAGACTATACAACTTCAAGAACACAGGGAAACCAGATCCGACCATGAACACGACATTGGTGTCACAACTTCGATATCTTTGTCCTCCAAGA
ACACAAAAGGGCCAAACCGATCCACTGGTTTACCTAAATCCAGACTCAGGCTCGAGCAACAGATTCACAAGCTCATACTACTCTCGTGTCTTGTCTCATAACGCTGTTTTACGGGTGGAC
CAAGAGTTGCTCAACAACGATGACTCGAAGGAGATCACGCAAGAGTTTGCTTCCGGTTTTGAAGATTTCAGAAAGTCTTTTGCTTTGGCAATGTCGAGAATGGGATCTATCAATGTTTTG
ACGGGAACAGCTGGAGAGATTCGTCGAGACTGCAGAGTTACCAACGCTAATGACGGGGCCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTTTG TGAATTTTTT CCCACTATTG GCCCTCGTAG TCATAAGCTT AGCCGGAAAG GCTACGGTAG AGGCTGCGAC GGGATTGAAC CCTCCGGTGA AGCTTGTCTG GCATTATTAC  AAACTTACTA ACACTTGTGA TGATGCAGAG ACTTATATTA GATACCAAGT TGAAAAGTTT TATAAGAATG ATAGTAGCAT TGCCCCAAAG CTGCTTCGTC TCCTCTACTC CGATTGTATG  GTTAATGGAT GTGATGGTTC GATTCTTTTG CAAGGACCAA ACTCAGAGAG GACAGCTCCA CAGAATCGAG GGCTTGGAGG TTTTGTGATA ATCGATAAAA TAAAGCAAGT TCTTGAATCA  CGTTGTCCTG GTGTCGTTTC TTGCGCTGAT ATCCTCAACC TTGCCACTAG AGATGCTGTT CACATGGCCG GAGCACCGTC TTATCCTGTG TTTACGGGGA GAAGGGACGG TGGGACATTA  AATGCAGACG CCGTAGATCT GCCGTCACCG TCCATCTCAG TCGATGAGTC ATTGGCATAT TTCAAGTCCA AAGGTCTTGA CGTTTTGGAT ATGACTACTC TTCTAGGAGC ACACTCAATG  GGGAAGACAC ATTGTAGCTA CGTAGTGGAC AGACTATACA ACTTCAAGAA CACAGGGAAA CCAGATCCGA CCATGAACAC GACATTGGTG TCACAACTTC GATATCTTTG TCCTCCAAGA  ACACAAAAGG GCCAAACCGA TCCACTGGTT TACCTAAATC CAGACTCAGG CTCGAGCAAC AGATTCACAA GCTCATACTA CTCTCGTGTC TTGTCTCATA ACGCTGTTTT ACGGGTGGAC  CAAGAGTTGC TCAACAACGA TGACTCGAAG GAGATCACGC AAGAGTTTGC TTCCGGTTTT GAAGATTTCA GAAAGTCTTT TGCTTTGGCA ATGTCGAGAA TGGGATCTAT CAATGTTTTG 
ACGGGAACAG CTGGAGAGAT TCGTCGAGAC TGCAGAGTTA CCAACGCTAA TGACGGGGCC TAA 

Retrieve as FASTA