Entry information : AtPrx66 ( At5g51890 / PER66 / AtperoxP66 / ATP27a / AtP27)
Entry ID 232
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2016-03-31 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-01 (Achraf Jemmat)
Peroxidase information: AtPrx66 ( At5g51890 / PER66 / AtperoxP66 / ATP27a / AtP27)
Name (synonym) AtPrx66 ( At5g51890 / PER66 / AtperoxP66 / ATP27a / AtP27)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Mixed tissues
Roots
Rosettes
Vascular tissue
Xylem
Inducer Lignification
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx66
start..stop
S start..stop
CagraPrx80 649 0 1..322 1..322
BstrPrx29 646 0 1..322 1..322
AlyPrx66 642 0 1..322 1..322
CrubPrx95 640 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21092123..21092335 213 N° 2 21091845..21092033 189 N° 3 21091163..21091729 567  
complement(join(21091163..21091729,21091845..21092033,21092123..21092335))


exon

Literature and cross-references AtPrx66 ( At5g51890 / PER66 / AtperoxP66 / ATP27a / AtP27)
Literature Tokunaga N, Kaneta T, Sato S, Sato Y. Analysis of expression profiles of three peroxidase genes associated with lignification in Arabidopsis thaliana. Physiol Plant. 2009 Jun;136(2):237-49.
Protein ref. UniProtKB:   Q9LT91
DNA ref. Phytozome 11:   Chr5 (21092335..21091163)
mRNA ref. GenBank:   NM_124568
Cluster/Prediction ref. Phytozome Gene 11:   19668136 UniGene:   At.25182
Omic ref. AtProteome:   At5g51890 ATTED-II:   At5g51890 e-FP Browser:   At5g51890 ePlant:   At5g51890 Genevestigator:   At5g51890 TAIR:   At5g51890
Protein sequence: AtPrx66 ( At5g51890 / PER66 / AtperoxP66 / ATP27a / AtP27)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (298)
PWM (Da):   %s   35537.18 (32887.7)  
PI (pH):   %s   9.77 (9.66) Peptide Signal:   %s   cut: 25 range:25-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKGLIFAMIFAVLAIVKPSEAALDAHYYDQSCPAAEKIILETVRNATLYDPKVPARLLRMFFHDCFIRGCDASILLDSTRSNQAEKDGPPNISVRSFYVIEDAKRKLEKACPRTVSCADVIAIAARDVVTLSGGPYWSVLKGRKDGTISRANETRNLPPPTFNVSQLIQSFAARGLSVKDMVTLSGGHTIGFSHCSSFESRLQNFSKFHDIDPSMNYAFAQTLKKKCPRTSNRGKNAGTVLDSTSSVFDNVYYKQILSGKGVFGSDQALLGDSRTKWIVETFAQDQKAFFREFAASMVKLGNFGVKETGQVRVNTRFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2), 4 cDNA and 11 ESTs. Cystein "C8" is missing.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCAGCCAGGA GAGAAGAGGT AAAAAGATCA CAAGTGAATA ATAATGATCA TTTCATTAGA GATAGTCATG CAAATCTTTT GACATCTCAC ATAAAGCTTG ATACAACCCA GTACCAGCTC  TTGGATCCTA TCAATGATAA ATTCTTAAGA GACAATGTCT TTGCTTTACT TCTAGCTGGG AGAGATACCA CTGCCTCTGC TCTCACTTGG TTCTTTTGGT TTTTGTCCGA AAACCCTCTA  GTGGTGACCA AGATTCGCCA AGAGATTGAC ATGAATCTAC CAAGAAGTTG TAGTGGCCAA GAGAGACCAT CTTGTGATCC AATGGAGTAC TTAAACAAAG ATGTACTTAA ACAAGATTTT  GGTCTTTATT TATGGGGTGG TGGGTAGGAT GAGAGCTGTA TGGGGAGAAG ATGCATTAGA ATTCAAGCCA GAGAGATGGA TTTCCGAGAC CGGAGAGTTA GCATTCAATG CCGGTCGAGA  ATATGCCATG GTAAACAAAG AGCTATGGTT CAAATGAAGA TTGTGGCGGT GGAGATATTA CAAAACTATG ACATCAAGGT TGCCAACGGG CAGAAGTTTG AGCCAGATAC TAGTTTAATT  CTTAAAATGA AGCATGGCTT TAAGGTTAAG ATTAACAAGA GATGTTCATC TTGATATTAG TGAAATAATC AAGTTCTTTT TTAAGTTCTA TTTCGAAACC ATAGCCTAAT TAAGAGTATT  AATAAGGAGA CAAGTTTAAG TGTGATCTAC CTTGAGGTTT AGTTTTTATT GTAGACAAAT TATAGTAATG GTTTTTTAAT GATTTCAATG ACAGTTTAGA AGAATGTAAC TCTCGATCCA  AGAATGATAA TTCATGAGTT AGTAAACTGA TGAAATCAAA AAAGAAATGT TGTTTCAATT ATTATACTGT ACCATTTTTA TTTCTACGAA TTACGAAACC ATTTCTTCTC TACCGAAACT  AAAGTAAACT AAACCGTAAC AAAAAATTTT GTTTCTTTGT TTTCAACCGT ATCCAAATTA TGTATCCAGT TTTTTTTGTT TTTTTTTTTT TTTTTTTTCT CATTGTTGAC AAAATAAGTA  ATTTTCTAAT TTAAAATTTT CTTCAAAAAA ATTTATTATA ATATCCGTAA CTACAATGCA AATAGTGCCG TACACGTGAG AAGCAAAACA AAAAAGATGC AGAAAAAAAA ATAGTACCAC  AAAATCCTTC ACCAACCGTA CTGCGAAGCC AAGGCAATTG AAACCAAACA CTGATAGGCA TAACTCAACA GTAGTTACCC TTTTTTGACC ATCTTCTCGT TTAATTCTCT TCTTTATTCA  TTTTCAATCT TACTCTATCC ACACACACAC GAACACATCA AAATGCCACC ATTTTACATC TGATTTTTAG TCTTCATTAC TCATATTTAA GCTTAAGTTA ATAACCACAA CAACCACCTT  TTCATGTGGT TTATTTGGCA CCATCCGTAT TCTAAACCGT TCGTGTTCTT TCCTTATTTG GCACCATCAA GATTCTATTT ACAATATTTT TTTTCAAGTG GCAAAACAAA AACAAATTAC  AATTTTTATA AATTAATTGA GTTAAAGAAA ATTACTTCCA GGTTCCATTA ATGTATCTAA AAATATTTAA GTAAAATTTT AATTACAATA ACATCCATTT ATTTTATATA AAAATTTTAA  AAAACGTTTT AATAGATTCT TTTAATAGTT ACCAAAAACA GATTCTGTCC AGCTCTTCTG CACCAAAGTA CATGCTTAGA CTCAAAGTAC GATTTTAGGG AGAAAAGAAT TTGAATACTG  GAATAGATAC ATGTTTGTTC CAAATAATTT GAGTAACTTT AAAGCATATG TTATACACAT ACACATTTTC TAGAATATTA GCCTCTCATT TCTCTCCTTA TATAAGCCAA ATAGTCCCCG 
CTTCTTCTCA TTCATCAAAT CCTCAAACAA CTTCAAGAAC AAAGAGTGCT TTTCGAGGCC CAAAACACAT TACCATAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGCATATTC CTAACAAGCA ACCAAATGAG AGTTTTCTTT TCTTCAAATT TGATTTCATT TATACTTGAT ATTATAATAA TGTAGACCGG CCAATATATG GATCGGTTTT AAAACCTCCT  AATTCTCCAT GAGTTGCAGA GTATGCTTTA AAAGTAAATT TGTTCTGCTT CATTGAACTG ATCTATAAAT TCATCAGCAT TTTCACTTAC TGGTCACTAA ATATGAATGA GCCATGGACT  CATGGCTTGT TATAAATGCT GAACCAGCGG GAACATGGGC TTGATTCAGG TAAATAGTGA TCTACACAAG CTTAATCGAT GGTTCTTAAT GTGTATGAAA GTAGTTAATG TGAGAAACAC  AAAATACAGA GAAGATGAAT GTCTTCTTCA TGCAAAAACA ACATCAGAAC GGAACACATA CTTGACGCCT TTGGAGACAT TCCTCCCTTC GTGCAACATG CACTTGTCTC CATGGATGTG  AAAGAGAGCC ATACCTTCCA CTGGAGCTAC CTGCGATAAT AAGCAAGTTT TAGTTGATGA GATCCATAAA ATATGAAACT AAGACAAACA AACTATTTGA GAGTTAATTA CCTCAGCTAC  AATACTGTTC CTTGAACCAT AAAAAACGGT TTCTCCACCT ACTAAAGGCT CAGCCGAAGA AGAATCGTTC GTCTTGCTTG AACTGCTCTT GGATTTTGAT TTTGTGCTGT TCCCGCTTAG  ATATATCAAC AATGTGTAAT AGGTCCGGTT TCCATCTTCA AGATCAGCAC TTTCATCGAT GTGACGACCA AAATGTTGAC CAGCACTATA CCTGAACATG ATATTAACAA AGTATCATAT  ACATCTTCCC ATCGTGACAC AAAATTTTGG AAGTAATCTA CAAAGCTGTA TCCTTTTTCA ATGCCAAATG AGAAACATGA CAAGAACAAC AACAAGAACA TATTCTTTAC ACATCTTCCC 
ATAATTAAAC CACTACCAGT AAAAAAAAGA ATGAAACTTC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCTCGAAGGGACTCATTTTTGCGATGATATTTGCGGTTTTAGCGATAGTTAAGCCCTCAGAAGCTGCTCTTGATGCTCATTACTATGATCAATCGTGCCCTGCTGCTGAAAAA
ATCATACTTGAAACTGTTAGGAATGCTACTTTGTATGATCCCAAAGTGCCTGCTCGTCTCCTAAGAATGTTCTTCCACGATTGCTTCATCAGG
GTATGCATCTTGATCTTCTTTATTTGA
TAGTTGATTGTTGATCCAGTTATATATGAAGTTGAGTTTTGAGTAAGGTTGGATTGTTGTAGGGATGTGATGCGTCCATTCTACTAGATTCGACACGGTCAAACCAAGCTGAGAAGGATG
GTCCTCCAAACATCTCAGTACGGTCATTTTACGTGATCGAAGATGCTAAGAGAAAGCTCGAAAAGGCTTGTCCTCGTACCGTGTCTTGTGCCGATGTAATCGCCATTGCCGCCAGAGATG
TGGTCACCCTG
GTGAGTCTTCGTAAAAGAGTTGTCCCTTTATGATCATATTAGTGTAATATAATTCTTTTACGGTTGAAATTTGGTTCTGTTTGATTTACCTTGTGTAATGTTTTACATT
TATTAGTCCGGTGGTCCTTATTGGAGCGTACTGAAAGGGCGAAAAGACGGGACAATTTCACGAGCCAACGAGACTAGAAATCTCCCACCACCAACGTTCAATGTTTCTCAACTGATACAA
AGCTTTGCAGCAAGAGGCTTGTCGGTGAAAGACATGGTTACGCTCTCAGGTGGCCACACCATAGGGTTCTCTCACTGTTCTTCTTTCGAGTCCCGTCTTCAAAACTTCAGCAAATTCCAT
GACATAGATCCTTCGATGAACTATGCGTTCGCGCAAACCTTGAAAAAGAAATGCCCGAGAACATCTAACCGAGGCAAGAACGCAGGGACAGTCTTGGACTCTACTTCCTCGGTTTTCGAC
AATGTTTACTACAAGCAAATTTTGTCCGGGAAAGGAGTGTTTGGGTCTGATCAGGCACTTCTAGGCGATTCCCGGACTAAGTGGATCGTTGAGACGTTTGCTCAAGACCAAAAAGCTTTC
TTCAGAGAGTTTGCAGCTTCCATGGTAAAACTTGGAAACTTTGGAGTCAAAGAGACTGGACAAGTTAGAGTTAACACTCGCTTCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCTCGAAGGGACTCATTTTTGCGATGATATTTGCGGTTTTAGCGATAGTTAAGCCCTCAGAAGCTGCTCTTGATGCTCATTACTATGATCAATCGTGCCCTGCTGCTGAAAAA
ATCATACTTGAAACTGTTAGGAATGCTACTTTGTATGATCCCAAAGTGCCTGCTCGTCTCCTAAGAATGTTCTTCCACGATTGCTTCATCAGG
GGATGTGATGCGTCCATTCTACTAGAT
TCGACACGGTCAAACCAAGCTGAGAAGGATGGTCCTCCAAACATCTCAGTACGGTCATTTTACGTGATCGAAGATGCTAAGAGAAAGCTCGAAAAGGCTTGTCCTCGTACCGTGTCTTGT
GCCGATGTAATCGCCATTGCCGCCAGAGATGTGGTCACCCTG
TCCGGTGGTCCTTATTGGAGCGTACTGAAAGGGCGAAAAGACGGGACAATTTCACGAGCCAACGAGACTAGAAATCTC
CCACCACCAACGTTCAATGTTTCTCAACTGATACAAAGCTTTGCAGCAAGAGGCTTGTCGGTGAAAGACATGGTTACGCTCTCAGGTGGCCACACCATAGGGTTCTCTCACTGTTCTTCT
TTCGAGTCCCGTCTTCAAAACTTCAGCAAATTCCATGACATAGATCCTTCGATGAACTATGCGTTCGCGCAAACCTTGAAAAAGAAATGCCCGAGAACATCTAACCGAGGCAAGAACGCA
GGGACAGTCTTGGACTCTACTTCCTCGGTTTTCGACAATGTTTACTACAAGCAAATTTTGTCCGGGAAAGGAGTGTTTGGGTCTGATCAGGCACTTCTAGGCGATTCCCGGACTAAGTGG
ATCGTTGAGACGTTTGCTCAAGACCAAAAAGCTTTCTTCAGAGAGTTTGCAGCTTCCATGGTAAAACTTGGAAACTTTGGAGTCAAAGAGACTGGACAAGTTAGAGTTAACACTCGCTTC
GTCAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTCATCAAA TCCTCAAACA ACTTCAAGAA CAAAGAGTGC TTTTCGAGGC CCAAAACACA TTACCATAAA ATGGCATTCT CGAAGGGACT CATTTTTGCG ATGATATTTG CGGTTTTAGC  GATAGTTAAG CCCTCAGAAG CTGCTCTTGA TGCTCATTAC TATGATCAAT CGTGCCCTGC TGCTGAAAAA ATCATACTTG AAACTGTTAG GAATGCTACT TTGTATGATC CCAAAGTGCC  TGCTCGTCTC CTAAGAATGT TCTTCCACGA TTGCTTCATC AGGGGATGTG ATGCGTCCAT TCTACTAGAT TCGACACGGT CAAACCAAGC TGAGAAGGAT GGTCCTCCAA ACATCTCAGT  ACGGTCATTT TACGTGATCG AAGATGCTAA GAGAAAGCTC GAAAAGGCTT GTCCTCGTAC CGTGTCTTGT GCCGATGTAA TCGCCATTGC CGCCAGAGAT GTGGTCACCC TGTCCGGTGG  TCCTTATTGG AGCGTACTGA AAGGGCGAAA AGACGGGACA ATTTCACGAG CCAACGAGAC TAGAAATCTC CCACCACCAA CGTTCAATGT TTCTCAACTG ATACAAAGCT TTGCAGCAAG  AGGCTTGTCG GTGAAAGACA TGGTTACGCT CTCAGGTGGC CACACCATAG GGTTCTCTCA CTGTTCTTCT TTCGAGTCCC GTCTTCAAAA CTTCAGCAAA TTCCATGACA TAGATCCTTC  GATGAACTAT GCGTTCGCGC AAACCTTGAA AAAGAAATGC CCGAGAACAT CTAACCGAGG CAAGAACGCA GGGACAGTCT TGGACTCTAC TTCCTCGGTT TTCGACAATG TTTACTACAA  GCAAATTTTG TCCGGGAAAG GAGTGTTTGG GTCTGATCAG GCACTTCTAG GCGATTCCCG GACTAAGTGG ATCGTTGAGA CGTTTGCTCA AGACCAAAAA GCTTTCTTCA GAGAGTTTGC  AGCTTCCATG GTAAAACTTG GAAACTTTGG AGTCAAAGAG ACTGGACAAG TTAGAGTTAA CACTCGCTTC GTCAACTAAA AGCATATTCC TAACAAGCAA CCAAATGAGA GTTTTCTTTT  CTTCAAATTT GATTTCATTT ATACTTGATA TTATAATAAT GTAGACCGGC CAATATATGG ATCGGTTTTA AAACCTCCTA ATTCTCCATG AGTTGCAGAG TATGCTTTAA AAGTAAATTT 
GTTCTGCTTC 

Retrieve as FASTA