Entry information : PcCIIBA01 (PcNOP01 / nop-a / nop-b)
Entry ID 2332
Creation 2007-02-07 (Christophe Dunand)
Last sequence changes 2011-11-24 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-04-29 (Christophe Dunand)
Peroxidase information: PcCIIBA01 (PcNOP01 / nop-a / nop-b)
Name (synonym) PcCIIBA01 (PcNOP01 / nop-a / nop-b)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcCIIBA01
start..stop
S start..stop
PgigCIIBA01 323 3e-111 8..312 5..310
CuniCIIBA02 319 8e-109 5..311 3..309
CuniCIIBA03 317 8e-108 4..312 8..324
DsCIIBA06 313 3e-106 4..311 2..310
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1250082..1250201 120 N° 2 1250258..1250301 44 N° 3 1250354..1250387 34 N° 4 1250443..1250456 14
N° 5 1250504..1250548 45 N° 6 1250600..1250613 14 N° 7 1250668..1250706 39 N° 8 1250760..1250838 79
N° 9 1250894..1251134 241 N° 10 1251201..1251254 54 N° 11 1251334..1251449 116 N° 12 1251500..1251528 29
N° 13 1251583..1251701 119  
join(1250082..1250201,1250258..1250301,1250354..1250387,1250443..1250456,1250504 ..1250548,1250600..1250613,1250668..1250706,1250760..1250838,1250894..1251134,12 51201..1251254,1251334..1251449,1251500..1251528,1251583..1251701)


exon

Literature and cross-references PcCIIBA01 (PcNOP01 / nop-a / nop-b)
Literature REFERENCE 1 Larrondo,L.F., Gonzalez,A., Perez-Acle,T., Cullen,D. and Vicuna,R. The nop gene from Phanerochaete chrysosporium encodes a peroxidase with novel structural features. Biophys Chem 2005 Jul 1, 116(2): 167-173.
REFERENCE 2 Martinez,D., Larrondo,L.F., Putnam,N., Sollewijn Gelpke,M.D., Huang,K., Chapman,J., Helfenbein,K.G., Ramaiya,P., Detter,J.C., Larimer,F., Coutinho,P.M., Henrissat,B., Berka,R., Cullen,D. and Rokhsar,D. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22 (6), 695-700 (2004).
Protein ref. UniProtKB:   Q5XXE3   Q5XXE5 [Mismatch]   Q5XXE2 [Other strain]
DNA ref. JGI genome:   scaffold_10 (1250082..1251701)
mRNA ref. GenBank:   AY727765
Protein sequence: PcCIIBA01 (PcNOP01 / nop-a / nop-b)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (295)
PWM (Da):   %s   33528.94 (31349.7) Transmb domain:   %s   i7-24o
PI (pH):   %s   6.9 (6.67) Peptide Signal:   %s   cut: 21 range:21-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHNLIKVIYILIIATVAAMAAPPSPNRVRCSAGREAGHPECCKWFDVREEIQDRLFNRSCGADVRSIRIQWHDAIAFSHTGGLKSGGGDGSILAHPIELAYPANVGLSDIAERQRALALKHNVSFGDFIQFASAVGLSNCEGAPRLTFLAGRPNASRAADDGLVPAPWHSADTLLARMADAGFAPHELVALLAGHSVATQQTVDASVGTPLDSTPRTFDNAFFVETQARGTVCPGAALHKGEALSSSPHELRLQSDGALARDPRTAPTWKRFEDQVEMARQFANAMAKLSVVGQDAASLVDCTDVVPRWRM

Retrieve as FASTA  
Remarks Complete sequence from genomic and mRNA. Strain="BKM1767", "RP-78" and "ME446". No EST. The 3'end looks shorter with missing conserved residues. This class II peroxidase has been called "NoP", i.e. "novel peroxidase", by its discoverers. It is considerably shorter than other class II peroxidases. Two SwissProt Q5XXE3 (nop-b) and Q5XXE5 (nop-a) submitted by the same authors (differs by a few amino acids). There is only ONE nop gene in the P.chrysosporium genome (BLAST in Joint Genome Institute).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACAACTTAATCAAGGTAATATACATTCTTATCATAGCGACGGTGGCTGCTATGGCTGCACCTCCGTCGCCGAATCGGGTCCGGTGTAGCGCAGGCCGCGAGGCAGGACATCCCGAG
GTGGGGCAAGCGTGCCGCGAGACAGTCGCCACGGGGAACTCACCTTGCACGCGCAGTGTTGCAAGTGGTTCGACGTCCGGGAGGAGATACAAGACAGGCTGTAAGCAGGTGCAGCGTCGT
CCACTCGAGTCCTCGATACTGAACGCGCACAGGTTCAACCGGTCGTGTGGTGCCGACGTCCGGAAGGTGCGACCAGCGTACAATGCTTGTTGCGACGGATCCTTGCTGACGTGGCGTCTA
GTCGATCCGTATCCAGTGAGCCCAGTGTGTCTCTGGTCCCGTCCCGGTCCTAAAGTCCGCAGGTGGCACGACGCCATCGCCTTCTCACACACGGGGGGATTGAAGAGGTACTGTCCAAGC
ATCTCCTAGCGTTCTGCCTTCTTTCTGAATATGAGCAGCGGTGGGGGCGCAGGTGCGTGATCCGTGTCTTACTCTCACAGCATTTGTTCTGAACGCATATATGCAGACGGCTCTATCCTC
GCACATCCCATCGAACTAGCCTACC
GTGAGCGACACCGTTCTCAACTAGCGCAAGCACACCCTGATACTCTGGTACAGCGGCGAATGTAGGCCTGTCCGACATCGCAGAGCGCCAGCGCG
CCCTCGCCCTGAAGCACAACGTATCCTTTGGCGACTT
GTGCGCGGATCCGCTGCTCCCACGCAGGTGCACCATCTGACGCCGTACCTTGCAGCATACAATTTGCAAGCGCCGTTGGGCTA
TCAAACTGCGAGGGTGCACCACGCCTGACGTTTCTCGCGGGACGGCCGAACGCCTCGCGAGCTGCGGACGACGGGCTGGTCCCCGCTCCATGGCACTCCGCCGACACCCTCTTGGCGCGG
ATGGCCGACGCCGGATTTGCCCCCCACGAGCTCGTCGCGCTGCTTGCGGGCCACAGCGTTGCGACCCAGCAAACGGTCGACGCGAGCGTCGCG
GTGCGTGACACATCGACGATTCCCGCG
TCGTCTTTGTCTTCGCGCTCATGGTGCCTGCTGTTGCAGGGCACGCCGCTGGATTCGACACCGCGCACGTTCGACAACGCGTTCTTTGTCGAGGTGAGCGTGTCCTGCCAGAGACGCGCG
AGGCGCAGATCGGCCGGGCGCTGATGACGGTTCCGTGCATGCCCCCCCTCAGACGCAGGCCAGAGGAACGGTCTGTCCCGGCGCTGCGCTGCACAAGGGCGAGGCCCTATCGTCCTCGCC
CCACGAGCTGCGACTACAGTCCGATGGCGCGCTCGCTCGAGATCCCAG
GTGCGTGTGCGCGACGTGGACCGCCTTGTCAAGACTGATGGACATGTCAGGACCGCCCCGACATGGAAACGG
TTTGCAG
GTGCGCTCAGGCCTCCCTCCGAGACTCCATACACATCTGAAGGTGTCCCTGCAGAGGATCAGGTCGAGATGGCAAGGCAGTTTGCGAACGCGATGGCGAAGCTGTCTGTCGTG
GGTCAGGATGCAGCCTCGCTGGTCGACTGCACGGACGTCGTCCCTCGATGGAGAATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACAACTTAATCAAGGTAATATACATTCTTATCATAGCGACGGTGGCTGCTATGGCTGCACCTCCGTCGCCGAATCGGGTCCGGTGTAGCGCAGGCCGCGAGGCAGGACATCCCGAG
TGTTGCAAGTGGTTCGACGTCCGGGAGGAGATACAAGACAGGCTGTTCAACCGGTCGTGTGGTGCCGACGTCCGGAAGTCGATCCGTATCCAGTGGCACGACGCCATCGCCTTCTCACAC
ACGGGGGGATTGAAGAG
CGGTGGGGGCGCAGACGGCTCTATCCTCGCACATCCCATCGAACTAGCCTACCCGGCGAATGTAGGCCTGTCCGACATCGCAGAGCGCCAGCGCGCCCTCGCC
CTGAAGCACAACGTATCCTTTGGCGACTT
CATACAATTTGCAAGCGCCGTTGGGCTATCAAACTGCGAGGGTGCACCACGCCTGACGTTTCTCGCGGGACGGCCGAACGCCTCGCGAGCT
GCGGACGACGGGCTGGTCCCCGCTCCATGGCACTCCGCCGACACCCTCTTGGCGCGGATGGCCGACGCCGGATTTGCCCCCCACGAGCTCGTCGCGCTGCTTGCGGGCCACAGCGTTGCG
ACCCAGCAAACGGTCGACGCGAGCGTCGCG
GGCACGCCGCTGGATTCGACACCGCGCACGTTCGACAACGCGTTCTTTGTCGAGACGCAGGCCAGAGGAACGGTCTGTCCCGGCGCTGCG
CTGCACAAGGGCGAGGCCCTATCGTCCTCGCCCCACGAGCTGCGACTACAGTCCGATGGCGCGCTCGCTCGAGATCCCAG
GACCGCCCCGACATGGAAACGGTTTGCAGAGGATCAGGTC
GAGATGGCAAGGCAGTTTGCGAACGCGATGGCGAAGCTGTCTGTCGTGGGTCAGGATGCAGCCTCGCTGGTCGACTGCACGGACGTCGTCCCTCGATGGAGAATGTAA

Retrieve as FASTA