Entry information : MgrCP02 (MagKatG2 / CPXB)
Entry ID 2337
Creation 2005-10-05 (Nenad Bakalovic)
Last sequence changes 2011-01-02 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrCP02 (MagKatG2 / CPXB)
Name (synonym) MgrCP02 (MagKatG2 / CPXB)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation Secreted
Tissue types Appressorium
Conidia
Mycelium
Pericarps
Inducers Hydrogen peroxide
Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value MgrCP02
start..stop
S start..stop
CgloCP01_ST23 1269 0 1..786 1..778
CfioCP02_PJ7 1237 0 20..783 18..775
CfioCP02_MH18 1236 0 20..783 18..775
CgraCP02 1220 0 1..783 1..775
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 162879..163194 316 N° 2 163311..163465 155 N° 3 163976..164048 73 N° 4 164170..164601 432
N° 5 164709..164844 136 N° 6 165603..166851 1249  
join(162879..163194,163311..163465,163976..164048,164170..164601,164709..164844, 165603..166851)


exon

Literature and cross-references MgrCP02 (MagKatG2 / CPXB)
Literature [1] Zamocky M., Furtmueller P.G., Obinger C. (2009). Two distinct groups of fungal catalase/peroxidases. Bioch. Soc. Trans. 37: 772-777
[2] Dean R.A., Talbot N.J., Ebbole D.J., Farman M.L., Mitchell T.K., Orbach M.J., Thon M.R., Kulkarni R., Xu J.-R., Pan H., Read N.D., Lee Y.-H., Carbone I., Brown D., Oh Y.Y., Donofrio N., Jeong J.S., Soanes D.M., Djonovic S., Kolomiets E., Rehmeyer C., Li W., Harding M., Kim S., Lebrun M.-H., Bohnert H., Coughlan S., Butler J., Calvo S.E., Ma L.-J., Nicol R., Purcell S., Nusbaum C., Galagan J.E., Birren B.W. (2005). The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434:980-986
[3] Zamocky M., Jakopitsch, C., Vlasits, J., and Obinger, C. (2007).Fungal catalase-peroxidases - a novel group of bifunctional oxidoreductases. J. Biol. Inorg. Chem. 12, Suppl.1, S97
[4] Tanabe S, Ishii-Minami N, Saitoh KI, Otake Y, Kaku H, Shibuya N, Nishizawa Y, and Minami E. (2011) The Role of Catalase-Peroxidase Secreted by Magnaporthe oryzae During Early Infection of Rice Cells. Mol. Plant-Micr. Interact. 24:163-171
Protein ref. GenPept:   EDJ95794 UniProtKB:   A4QUT2
DNA ref. JGI genome:   Supercontig_6.14 (162879..166851)
EST ref. GenBank:   CK916856.1 [3' end]   CD034008.1 [3' end]   GT931436.1 [3' end]   BM868464.2 [Fragment]   HS587019.1 [Fragment]
Protein sequence: MgrCP02 (MagKatG2 / CPXB)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   786 (763)
PWM (Da):   %s   85405.44 (83055.2)  
PI (pH):   %s   5.38 (5.29) Peptide Signal:   %s   cut: 24 range:24-786
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHASLSSWLLAASLLTQPISVSGQGCPFAKRDGTVDSSLPQKRADAPETTTFGRCAVKSNQAGGGTRSHDWWPCQLRLDVLRQFQPSQNPLGGDFDYAEAFQSLDYEAVKKDIAALMTESQDWWPADFGNYGGLFVRMAWHSAGTYRAMDGRGGGGGQQRFAPLNSWPDNQNLDKARRLIWPIKQKYGNKISWADLMLLTGNVALENMGFKTLGFGGGRADTWQSDEAVYWGAETTFVPQGNDVRYNNSVDINARADKLEKPLAATHMGLIYVNPEGPNGTPDPAASAKDIREAFGRMGMNDTETVALIAGGHAFGKTHGAVKGSNIGPAPEAADLGMQGLGWHNSVGDGNGPNQMTSGLEVIWTKTPTKWSNGYLESLINNNWTLVESPAGAHQWEAVNGTVDYPDPFDKTKFRKATMLTSDLALINDPEYLKISQRWLEHPEELADAFAKAWFKLLHRDLGPTTRYLGPEVPKESFIWQDPLPAREGDLIDDADVDKLKAAILSTDGLDVSKLASTAMACATTYRNSDKRGGCNGARIALEPQRNWVSNNPTQLSAVLDALKKVQSDFNGSNGNKKVSLADLIVLGGTAAVEKAAKDAGVDIKVPFSAGRVDATQEQTDVTQFSYLEPQADGFRNYGRGTARARTEEIMVDKASQLTLTPPELTVLVGGMRALGANYDGSDVGVFTANKGKLTPDFFVNLVDMNIAWTASGADGESWVGTDRKSRSEKYKGSRADLVFGSHAELRAIAEVYAENGNQEKFVKDFVAAWTKVMNLDRFDLKVKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo VI, 5 introns) and 10 ESTs - most of them on the C-terminus, no EST covers the N-terminus. Strain="70-15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCATCACTCTCAAGTTGGCTGCTCGCAGCCTCGCTCCTGACGCAGCCCATCAGCGTCTCGGGCCAGGGCTGCCCCTTTGCAAAGAGAGATGGGACCGTGGACAGCAGCCTTCCC
CAGAAAAGGGCTGATGCGCCAGAGACGACGACCTTTGGACGATGCGCGGTGAAGAGCAACCAGGCCGGCGGCGGCACGAGGAGTCACGACTGGTGGCCATGCCAGCTCCGGCTCGACGTG
CTACGTCAGTTCCAGCCGAGCCAGAACCCCCTCGGCGGCGACTTTGACTACGCCGAGGCGTTTCAATCTCTGGATT
GTATGTTTTTTTTTCTCTTTCTGGCTCTTTTGCTTTTTGTTGCT
CATCTCGTTCATGTACCAAATTGTGGCAACAACGCCCGTACTGACAAGAAGCAAAAATGACTTGTGCCACAGACGAAGCCGTCAAGAAGGATATCGCGGCTCTGATGACAGAGTCGCAAG
ATTGGTGGCCTGCCGACTTTGGCAACTACGGTGGTCTGTTTGTCCGTATGGCGTGGCACAGTGCCGGTACCTACCGGGCCATGGACGGCCGTGGCGGTGGTGGAATG
GTGAGTGAAAGCT
GCGACTTTGGACTATGTCACCCTCCATCCCATGTTTTTGCTCCTCTTTTCTTCCCGCCCGACTATCTCTTCACTTTTGCCACCAGCACGAACCACCCACCATCAATTTTGTTGTACTTGT
ACTACAATAAAATAGTGGCCCGTGGGGGAGGCAAATTGATCAGGGATCAAATTGACTCGGCAACTTGCCCGCATTTTTCCCACGCACCGCACCCACTTTATTTACACAAACCTTCCAAGC
CTTCATCACATATCGAACCCACACACCCCCATGTCCATACTCAGACCTGTCAGACTGGACCTTGCCCATAACCATTTTCACCATCCATCCGAGCGGAGCCTTTGTTCCCCCTTGCTGCCC
TACGTCTGTGGGAGGGAATAAACTCTTTTCTTGGCATTCACCATTGTGTGGTGTGCCTTGGCGCAACCACCATGATAGGCATGCATATCGGACGTGTGAGTGACTAGCTAACTTTGGATT
TCTTTGACAAATGACAGGGTCAGCAACGATTTGCTCCCCTCAACAGCTGGCCCGACAACCAAAACCTGGACAAAGCTAGGCGGCTGATTTGTAAGTTTGCAAATGCCTTGTGTGAATGCC
TTGGTTTGCCGGGTTGAGTCGGTGCATGATGGATGCATGTGAAAAAAAAAGGAAGACGGCAAAACTGACAAATTTATCTTGTGACATGCAGGGCCCATCAAGCAAAAGTATGGCAACAAG
ATCTCATGGGCCGACCTGATGCTCCTTACGGGCAACGTCGCGCTCGAGAACATGGGCTTCAAGACGCTTGGATTCGGCGGTGGCAGGGCCGACACGTGGCAGTCGGACGAGGCGGTCTAC
TGGGGTGCCGAGACCACCTTTGTGCCGCAGGGCAACGACGTCCGCTACAACAACAGCGTCGACATCAACGCGCGCGCCGACAAGCTCGAGAAGCCGCTGGCCGCCACCCACATGGGTCTG
ATCTACGTCAACCCCGAGGGTCCCAACGGCACGCCTGACCCGGCCGCCTCGGCCAAGGACATCCGCGAGGCCTTTGGCAGGATGGGCATGAACGACACCGAGACTGTGGCTCTGATTGCC
GGCGGTCACGCCTTTGGCAAGACGCATGGTGCCGTCAAGGGCT
GTGAGTGGTTGACCCGCACGAGAGACGACATGTTGCAAATGTTTCCCGAAATATCTTTCTTTTTTTTCTGTGCTGCT
TACTGACTGTTTCTGTCTCCTTCTCTGCAGCAAATATTGGCCCCGCCCCTGAGGCTGCTGACCTTGGCATGCAGGGTCTCGGATGGCACAACAGTGTCGGCGACGGCAACGGCCCCAACC
AGATGACGAGCGGTCTGGAGGTTATCTGGACCAAGACTCCTACCAA
GTGAGTCTTTTTTTTCTTCCTCTTGTTATCAGTCGACCCCCCTTGTCCTTGTCCCTTTTCCGTTGTCTAGCCTT
CACTTGCCCCCTTCTATTCCAACCCAGGAATAGGATCATCAATAAGATGATCATCATCTGCCCCTCAACTTGGCGCGTCTTAACCCACTTAAGAATGTGGCTCCCGAATTGGGGCTCATT
CTGGCATATCTTTATTTTTCTTTTTTCTTTTTCTTTTTTTTTCTTGTCTTTGAGTGGTCGTTCTCCCGTTTTTTCTTTTTTCCCCTCTGTCTCTGCACTTTGCCTTGTTTCGGTGTGGTT
GTGTTTTGCCTCACTTCTTGGCGTTACCACCTCCCCAAAAAAAGATCAAGACATGCAAAAGAGGCAGGGGTTCAAGGGGTCTCACCTTCTGCAAGGACCCACTAGCCTTGCCGTCGCTTC
GCCCCGAAAAAAAAGCACGAACCTATTTTTATCTCCCCGATCACAATCACAATTACTGTCGCCCAGTGGGTGGCATACATTGTGACGGCAAGGTGCATATCTTATGTATGCAACCCTACA
ACGGAACCCTTCTTGGCGCAGTGCCGTGGGGGTGGACGGGATATGAGTGGTTGGCGCCGTTGGACGACATACTTTTGTCCCATTTTGTCTTGAATTCTTTCTCTGTTTTTTTGCCCCGAT
CACAACACAATTGCCAAGGCTCAATCAGCAACCACACACACATGCAACGACAGCATCAACTAATCATCACATCCACTACAACAGATGGAGCAATGGTTACCTCGAGTCCCTCATCAACAA
CAACTGGACCCTTGTCGAGTCTCCCGCCGGCGCGCATCAGTGGGAGGCGGTCAACGGCACCGTCGACTACCCTGACCCCTTTGACAAGACCAAGTTCCGCAAGGCTACCATGTTGACCTC
AGACTTGGCGCTGATCAACGACCCCGAGTACCTCAAGATCTCGCAGCGCTGGCTCGAGCACCCCGAGGAGCTGGCCGACGCCTTTGCCAAGGCCTGGTTCAAGCTCCTGCACCGTGACCT
TGGCCCCACCACCAGGTATCTCGGCCCCGAGGTTCCCAAGGAGTCCTTCATCTGGCAGGACCCGCTCCCCGCCCGGGAGGGTGACCTGATTGACGATGCCGACGTCGACAAGCTCAAGGC
CGCCATCCTCTCCACCGACGGTCTGGACGTCTCCAAGCTCGCCTCCACCGCCATGGCCTGCGCCACCACCTACCGCAACTCTGACAAGCGCGGCGGCTGCAACGGAGCCCGCATCGCCCT
CGAGCCCCAGAGGAACTGGGTCTCCAACAACCCCACTCAGCTGTCTGCCGTCCTCGACGCCCTCAAGAAGGTCCAGTCCGACTTTAACGGCAGCAACGGCAACAAGAAGGTCTCGCTGGC
CGATCTGATCGTGCTCGGTGGCACCGCCGCCGTGGAAAAGGCCGCCAAGGACGCCGGTGTCGACATCAAGGTCCCCTTCTCTGCGGGCCGTGTCGACGCCACCCAGGAGCAGACCGACGT
CACGCAGTTCTCGTACCTCGAGCCCCAGGCCGACGGTTTCCGCAACTACGGCCGTGGCACCGCCCGCGCCCGCACCGAGGAGATCATGGTCGACAAGGCCTCGCAGCTGACCCTGACTCC
CCCCGAGCTGACCGTCTTGGTTGGTGGCATGCGCGCTCTGGGCGCCAACTACGACGGCTCCGACGTCGGCGTCTTTACCGCCAACAAGGGCAAGCTGACTCCCGACTTCTTTGTCAACCT
GGTCGACATGAACATCGCCTGGACCGCCTCGGGCGCCGACGGCGAGAGCTGGGTCGGCACCGACAGGAAGAGCAGGAGCGAAAAGTACAAGGGCTCGCGCGCCGATCTCGTCTTTGGCTC
GCACGCCGAGCTGAGGGCCATCGCCGAGGTCTACGCCGAGAACGGCAACCAGGAGAAGTTTGTCAAGGACTTTGTCGCCGCCTGGACAAAGGTCATGAACCTTGACCGCTTCGACCTCAA
GGTCAAGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCATCACTCTCAAGTTGGCTGCTCGCAGCCTCGCTCCTGACGCAGCCCATCAGCGTCTCGGGCCAGGGCTGCCCCTTTGCAAAGAGAGATGGGACCGTGGACAGCAGCCTTCCC
CAGAAAAGGGCTGATGCGCCAGAGACGACGACCTTTGGACGATGCGCGGTGAAGAGCAACCAGGCCGGCGGCGGCACGAGGAGTCACGACTGGTGGCCATGCCAGCTCCGGCTCGACGTG
CTACGTCAGTTCCAGCCGAGCCAGAACCCCCTCGGCGGCGACTTTGACTACGCCGAGGCGTTTCAATCTCTGGATT
ACGAAGCCGTCAAGAAGGATATCGCGGCTCTGATGACAGAGTCG
CAAGATTGGTGGCCTGCCGACTTTGGCAACTACGGTGGTCTGTTTGTCCGTATGGCGTGGCACAGTGCCGGTACCTACCGGGCCATGGACGGCCGTGGCGGTGGTGGAATG
GGTCAGCAA
CGATTTGCTCCCCTCAACAGCTGGCCCGACAACCAAAACCTGGACAAAGCTAGGCGGCTGATTT
GGCCCATCAAGCAAAAGTATGGCAACAAGATCTCATGGGCCGACCTGATGCTCCTT
ACGGGCAACGTCGCGCTCGAGAACATGGGCTTCAAGACGCTTGGATTCGGCGGTGGCAGGGCCGACACGTGGCAGTCGGACGAGGCGGTCTACTGGGGTGCCGAGACCACCTTTGTGCCG
CAGGGCAACGACGTCCGCTACAACAACAGCGTCGACATCAACGCGCGCGCCGACAAGCTCGAGAAGCCGCTGGCCGCCACCCACATGGGTCTGATCTACGTCAACCCCGAGGGTCCCAAC
GGCACGCCTGACCCGGCCGCCTCGGCCAAGGACATCCGCGAGGCCTTTGGCAGGATGGGCATGAACGACACCGAGACTGTGGCTCTGATTGCCGGCGGTCACGCCTTTGGCAAGACGCAT
GGTGCCGTCAAGGGCT
CAAATATTGGCCCCGCCCCTGAGGCTGCTGACCTTGGCATGCAGGGTCTCGGATGGCACAACAGTGTCGGCGACGGCAACGGCCCCAACCAGATGACGAGCGGT
CTGGAGGTTATCTGGACCAAGACTCCTACCAA
ATGGAGCAATGGTTACCTCGAGTCCCTCATCAACAACAACTGGACCCTTGTCGAGTCTCCCGCCGGCGCGCATCAGTGGGAGGCGGTC
AACGGCACCGTCGACTACCCTGACCCCTTTGACAAGACCAAGTTCCGCAAGGCTACCATGTTGACCTCAGACTTGGCGCTGATCAACGACCCCGAGTACCTCAAGATCTCGCAGCGCTGG
CTCGAGCACCCCGAGGAGCTGGCCGACGCCTTTGCCAAGGCCTGGTTCAAGCTCCTGCACCGTGACCTTGGCCCCACCACCAGGTATCTCGGCCCCGAGGTTCCCAAGGAGTCCTTCATC
TGGCAGGACCCGCTCCCCGCCCGGGAGGGTGACCTGATTGACGATGCCGACGTCGACAAGCTCAAGGCCGCCATCCTCTCCACCGACGGTCTGGACGTCTCCAAGCTCGCCTCCACCGCC
ATGGCCTGCGCCACCACCTACCGCAACTCTGACAAGCGCGGCGGCTGCAACGGAGCCCGCATCGCCCTCGAGCCCCAGAGGAACTGGGTCTCCAACAACCCCACTCAGCTGTCTGCCGTC
CTCGACGCCCTCAAGAAGGTCCAGTCCGACTTTAACGGCAGCAACGGCAACAAGAAGGTCTCGCTGGCCGATCTGATCGTGCTCGGTGGCACCGCCGCCGTGGAAAAGGCCGCCAAGGAC
GCCGGTGTCGACATCAAGGTCCCCTTCTCTGCGGGCCGTGTCGACGCCACCCAGGAGCAGACCGACGTCACGCAGTTCTCGTACCTCGAGCCCCAGGCCGACGGTTTCCGCAACTACGGC
CGTGGCACCGCCCGCGCCCGCACCGAGGAGATCATGGTCGACAAGGCCTCGCAGCTGACCCTGACTCCCCCCGAGCTGACCGTCTTGGTTGGTGGCATGCGCGCTCTGGGCGCCAACTAC
GACGGCTCCGACGTCGGCGTCTTTACCGCCAACAAGGGCAAGCTGACTCCCGACTTCTTTGTCAACCTGGTCGACATGAACATCGCCTGGACCGCCTCGGGCGCCGACGGCGAGAGCTGG
GTCGGCACCGACAGGAAGAGCAGGAGCGAAAAGTACAAGGGCTCGCGCGCCGATCTCGTCTTTGGCTCGCACGCCGAGCTGAGGGCCATCGCCGAGGTCTACGCCGAGAACGGCAACCAG
GAGAAGTTTGTCAAGGACTTTGTCGCCGCCTGGACAAAGGTCATGAACCTTGACCGCTTCGACCTCAAGGTCAAGAAATAA

Retrieve as FASTA