Entry information : GzCP02 (GzKatG2)
Entry ID 2338
Creation 2006-07-03 (Nenad Bakalovic)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-22 (Achraf Jemmat)
Peroxidase information: GzCP02 (GzKatG2)
Name (synonym) GzCP02 (GzKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation Secreted
Tissue type Mycelium
Inducer Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value GzCP02
start..stop
S start..stop
FoCP02-1 1366 0 1..777 1..777
FoCP03 1364 0 1..777 1..777
FoCP04 1361 0 1..777 1..777
GmoCP02 1353 0 1..777 1..777
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2556909..2557194 286 N° 2 2557245..2557472 228 N° 3 2557520..2557951 432 N° 4 2558005..2558140 136
N° 5 2558192..2559443 1252  
join(2556909..2557194,2557245..2557472,2557520..2557951,2558005..2558140,2558192 ..2559443)


exon

Literature and cross-references GzCP02 (GzKatG2)
Literature Birren,B. et al., Fusarium graminearum genome sequence, unpublished; Zamocky M., Jakopitsch, C., Vlasits, J. and Obinger, C. Fungal catalase-peroxidases - a novel group of bifunctional oxidoreductases. J. Biol. Inorg. Chem. 12 (Suppl.1) S97
DNA ref. JGI genome:   Supercontig_3.2 (2556909..2559443)
EST ref. GenBank:   FD528596 (1..914) [Fragment]
Protein sequence: GzCP02 (GzKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   777 (759)
PWM (Da):   %s   85284.11 (83523.1)  
PI (pH):   %s   6.64 (6.47) Peptide Signal:   %s   cut: 19 range:19-777
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHAKTLLLAAGLAQLASADCPFAAKRDTQQNLLPPREIAEDFGRCRIASNQAGGGTRSTDFWPCQLRLDVLRQFSPQFNPLGEDFDYAEAFKSLDFEALKKDIHALLTESQDWWPADFGHYGGLFIRMAWHSAGTYRAMDGRGGGGMGQQRFAPLNSWPDNQNLDKARRLIWPIKQKYGNKISWADLMLLCGNIALESSNFKTLGFAGGRPDTWQADESIYWGAETTFVPKGNDVRYNGSTDIYERADKLEKPLGATHFGLIYVNPEGPNGTPDPKASALDIREAFGRMGMDDEETAALIIGGHTLGKTHGAVPGKNIGPEPEAADLGEMGLGWHNRVGEGNGPNQQTSGLEVIWSKTPTKWSNHFLESLLGNQWTLVKSPAGAHQWEALNGTVDYPDPFVKGKFRRATMLTSDLALINDDSYHKICKRWLKNPEEMNEAFAKAWYKLLHRDLGTASRYLGPDVPNEKFIWQDPLPERKGDVITDEDISSLKTAILGADGLDVSKLVSTAWKSASTFRGTDKRGGANGGRIALEPQVNWASNNPKQLKQVLSALKSVQKEFNAKSGSKQVSLADLIVLGGVAAVEKAAKDAGLKDVVVPFTPGRVDATQEMTDITQFNYLEPLADGFTNYGHGTARARTEEILVDRAGLLTLTPPEMTVLVGGLRALNANFDGSSNGILTEKKGQLTNDFFVNLLSPAYKWSKKDERGELWTATDRSTKSTKWTATRADLVFGSHAELRAISEVYGSADAKEKFAKDFIAAWTKVMNLDRFDVKVSK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 6 introns). Strain="PH-1". Signal sequence for secretion predicted with SignalP 3.0 Server: max. cleavage site probability 0.95 between positions 18 and 19.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCCAAAACTCTCTTGCTGGCCGCTGGCCTGGCGCAACTTGCGTCTGCCGACTGCCCCTTCGCCGCCAAGCGTGATACCCAGCAGAACTTGTTGCCCCCAAGAGAAATCGCCGAA
GACTTTGGACGATGCCGCATCGCCAGTAACCAGGCTGGTGGCGGTACACGAAGCACAGACTTTTGGCCTTGCCAGCTACGCCTCGATGTTCTACGACAGTTCTCGCCACAGTTCAACCCA
CTAGGCGAGGATTTCGACTACGCCGAAGCTTTCAAGTCTCTGGATT
GTGAGTACCAGCACTCAATTCTTCATGAATAAGTTGCTAACAACCTTTAGTCGAGGCTCTCAAGAAGGACATCC
ACGCTCTTCTTACTGAGTCTCAGGACTGGTGGCCCGCTGACTTCGGTCACTACGGAGGTCTCTTCATCCGTATGGCCTGGCACAGCGCCGGTACTTACCGTGCCATGGACGGCCGCGGTG
GTGGCGGAATGGGTCAACAGCGATTCGCTCCCCTCAACAGCTGGCCCGATAACCAGAACCTTGACAAGGCTCGTCGTCTAATTT
GTATGTCTCGCTACCCCCACTGAAAACTCACATTCT
AACAAACTCAGGGCCCATCAAGCAGAAGTACGGCAACAAGATCTCTTGGGCTGATCTTATGCTCCTTTGTGGTAACATTGCCCTCGAGAGCTCAAACTTCAAGACCCTTGGTTTCGCCGG
TGGCCGTCCCGACACCTGGCAAGCCGATGAGTCCATCTACTGGGGTGCCGAGACTACATTCGTCCCCAAGGGTAACGATGTCCGCTACAACGGCAGCACTGACATCTACGAGCGTGCCGA
CAAGCTCGAGAAGCCTCTTGGTGCTACTCACTTCGGTCTGATCTACGTCAACCCTGAGGGTCCTAACGGTACCCCCGACCCCAAGGCTTCCGCCCTTGATATCCGTGAGGCCTTTGGCCG
TATGGGCATGGACGATGAGGAGACCGCTGCTCTTATCATCGGTGGACACACCCTTGGAAAGACTCACGGTGCTGTTCCCGGAA
GTAAGTAGATATCGTCTTGAACTCCAACAGAGCATTG
ACTAATTGTTACGCAGAGAACATTGGCCCTGAGCCTGAGGCTGCTGACCTTGGAGAGATGGGTCTCGGATGGCACAACCGTGTTGGTGAGGGCAACGGCCCCAACCAGCAGACCAGTGGT
CTCGAAGTTATCTGGTCCAAGACCCCTACCAA
GTGAGTCTAATCGCATACTACTTTCCCTCCACTCATACTAACAAATCTCAGGTGGAGCAACCACTTCCTCGAGAGTCTTCTCGGCAAC
CAATGGACCCTCGTCAAGTCTCCAGCTGGCGCCCACCAGTGGGAGGCACTCAACGGCACTGTTGACTACCCCGATCCTTTCGTCAAGGGCAAGTTCCGCCGCGCCACCATGCTCACCTCT
GATCTCGCCCTCATCAACGACGACTCCTACCACAAGATTTGCAAGCGCTGGCTCAAGAACCCCGAGGAGATGAACGAGGCCTTCGCAAAGGCCTGGTACAAGCTTCTCCACCGTGATCTC
GGGACTGCTTCTCGATACCTCGGACCCGATGTCCCTAACGAGAAGTTCATCTGGCAAGATCCCCTCCCTGAGCGCAAGGGAGATGTTATCACCGACGAGGATATTTCTAGCCTCAAGACT
GCCATTCTCGGAGCCGACGGTCTCGATGTTTCCAAGCTGGTTTCTACTGCCTGGAAATCCGCTTCTACCTTCCGTGGAACCGACAAGCGTGGTGGTGCCAACGGTGGCCGCATTGCTCTC
GAGCCTCAAGTCAACTGGGCCAGCAACAACCCCAAGCAACTCAAGCAGGTCCTGTCTGCTCTCAAGAGCGTCCAGAAGGAGTTCAACGCCAAGTCCGGCTCCAAGCAGGTTTCCCTTGCC
GATCTTATTGTTCTCGGCGGTGTTGCCGCTGTTGAGAAGGCTGCCAAGGATGCCGGTCTTAAGGACGTTGTCGTTCCCTTCACCCCTGGCCGTGTCGATGCTACTCAGGAGATGACCGAC
ATCACCCAGTTCAACTACCTCGAGCCCCTCGCCGATGGCTTCACCAACTATGGACACGGAACTGCTCGTGCTCGCACCGAGGAGATTCTTGTCGACCGTGCTGGTCTCCTTACTCTTACC
CCACCTGAGATGACCGTCCTCGTCGGAGGTCTCCGTGCTCTCAACGCCAACTTTGACGGCTCATCCAACGGTATCTTGACCGAGAAGAAGGGTCAATTGACCAACGACTTCTTCGTCAAC
CTTCTGTCCCCTGCCTACAAGTGGTCCAAGAAGGACGAGCGCGGCGAGCTCTGGACTGCCACCGACCGTTCTACCAAGTCCACCAAGTGGACTGCCACACGCGCTGATCTTGTCTTCGGA
TCTCACGCCGAGCTCCGTGCTATTTCTGAAGTTTACGGTAGCGCTGATGCCAAGGAGAAGTTCGCCAAGGACTTCATTGCTGCTTGGACCAAGGTCATGAACCTTGATCGCTTCGACGTC
AAGGTGAGCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCCAAAACTCTCTTGCTGGCCGCTGGCCTGGCGCAACTTGCGTCTGCCGACTGCCCCTTCGCCGCCAAGCGTGATACCCAGCAGAACTTGTTGCCCCCAAGAGAAATCGCCGAA
GACTTTGGACGATGCCGCATCGCCAGTAACCAGGCTGGTGGCGGTACACGAAGCACAGACTTTTGGCCTTGCCAGCTACGCCTCGATGTTCTACGACAGTTCTCGCCACAGTTCAACCCA
CTAGGCGAGGATTTCGACTACGCCGAAGCTTTCAAGTCTCTGGATT
TCGAGGCTCTCAAGAAGGACATCCACGCTCTTCTTACTGAGTCTCAGGACTGGTGGCCCGCTGACTTCGGTCAC
TACGGAGGTCTCTTCATCCGTATGGCCTGGCACAGCGCCGGTACTTACCGTGCCATGGACGGCCGCGGTGGTGGCGGAATGGGTCAACAGCGATTCGCTCCCCTCAACAGCTGGCCCGAT
AACCAGAACCTTGACAAGGCTCGTCGTCTAATTT
GGCCCATCAAGCAGAAGTACGGCAACAAGATCTCTTGGGCTGATCTTATGCTCCTTTGTGGTAACATTGCCCTCGAGAGCTCAAAC
TTCAAGACCCTTGGTTTCGCCGGTGGCCGTCCCGACACCTGGCAAGCCGATGAGTCCATCTACTGGGGTGCCGAGACTACATTCGTCCCCAAGGGTAACGATGTCCGCTACAACGGCAGC
ACTGACATCTACGAGCGTGCCGACAAGCTCGAGAAGCCTCTTGGTGCTACTCACTTCGGTCTGATCTACGTCAACCCTGAGGGTCCTAACGGTACCCCCGACCCCAAGGCTTCCGCCCTT
GATATCCGTGAGGCCTTTGGCCGTATGGGCATGGACGATGAGGAGACCGCTGCTCTTATCATCGGTGGACACACCCTTGGAAAGACTCACGGTGCTGTTCCCGGAA
AGAACATTGGCCCT
GAGCCTGAGGCTGCTGACCTTGGAGAGATGGGTCTCGGATGGCACAACCGTGTTGGTGAGGGCAACGGCCCCAACCAGCAGACCAGTGGTCTCGAAGTTATCTGGTCCAAGACCCCTACC
AA
GTGGAGCAACCACTTCCTCGAGAGTCTTCTCGGCAACCAATGGACCCTCGTCAAGTCTCCAGCTGGCGCCCACCAGTGGGAGGCACTCAACGGCACTGTTGACTACCCCGATCCTTTC
GTCAAGGGCAAGTTCCGCCGCGCCACCATGCTCACCTCTGATCTCGCCCTCATCAACGACGACTCCTACCACAAGATTTGCAAGCGCTGGCTCAAGAACCCCGAGGAGATGAACGAGGCC
TTCGCAAAGGCCTGGTACAAGCTTCTCCACCGTGATCTCGGGACTGCTTCTCGATACCTCGGACCCGATGTCCCTAACGAGAAGTTCATCTGGCAAGATCCCCTCCCTGAGCGCAAGGGA
GATGTTATCACCGACGAGGATATTTCTAGCCTCAAGACTGCCATTCTCGGAGCCGACGGTCTCGATGTTTCCAAGCTGGTTTCTACTGCCTGGAAATCCGCTTCTACCTTCCGTGGAACC
GACAAGCGTGGTGGTGCCAACGGTGGCCGCATTGCTCTCGAGCCTCAAGTCAACTGGGCCAGCAACAACCCCAAGCAACTCAAGCAGGTCCTGTCTGCTCTCAAGAGCGTCCAGAAGGAG
TTCAACGCCAAGTCCGGCTCCAAGCAGGTTTCCCTTGCCGATCTTATTGTTCTCGGCGGTGTTGCCGCTGTTGAGAAGGCTGCCAAGGATGCCGGTCTTAAGGACGTTGTCGTTCCCTTC
ACCCCTGGCCGTGTCGATGCTACTCAGGAGATGACCGACATCACCCAGTTCAACTACCTCGAGCCCCTCGCCGATGGCTTCACCAACTATGGACACGGAACTGCTCGTGCTCGCACCGAG
GAGATTCTTGTCGACCGTGCTGGTCTCCTTACTCTTACCCCACCTGAGATGACCGTCCTCGTCGGAGGTCTCCGTGCTCTCAACGCCAACTTTGACGGCTCATCCAACGGTATCTTGACC
GAGAAGAAGGGTCAATTGACCAACGACTTCTTCGTCAACCTTCTGTCCCCTGCCTACAAGTGGTCCAAGAAGGACGAGCGCGGCGAGCTCTGGACTGCCACCGACCGTTCTACCAAGTCC
ACCAAGTGGACTGCCACACGCGCTGATCTTGTCTTCGGATCTCACGCCGAGCTCCGTGCTATTTCTGAAGTTTACGGTAGCGCTGATGCCAAGGAGAAGTTCGCCAAGGACTTCATTGCT
GCTTGGACCAAGGTCATGAACCTTGATCGCTTCGACGTCAAGGTGAGCAAGTAG

Retrieve as FASTA